ID: 1171227511

View in Genome Browser
Species Human (GRCh38)
Location 20:23453513-23453535
Sequence TCCCATCAGGTCCCCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171227511_1171227524 28 Left 1171227511 20:23453513-23453535 CCCATCCTGGGGACCTGATGGGA No data
Right 1171227524 20:23453564-23453586 AGGAAGAAGCCACTGGTGGGTGG No data
1171227511_1171227519 8 Left 1171227511 20:23453513-23453535 CCCATCCTGGGGACCTGATGGGA No data
Right 1171227519 20:23453544-23453566 ACTTGGCTGCCAGTTAGAGAAGG No data
1171227511_1171227522 24 Left 1171227511 20:23453513-23453535 CCCATCCTGGGGACCTGATGGGA No data
Right 1171227522 20:23453560-23453582 GAGAAGGAAGAAGCCACTGGTGG No data
1171227511_1171227515 -9 Left 1171227511 20:23453513-23453535 CCCATCCTGGGGACCTGATGGGA No data
Right 1171227515 20:23453527-23453549 CTGATGGGAGTCCCCAGACTTGG No data
1171227511_1171227523 25 Left 1171227511 20:23453513-23453535 CCCATCCTGGGGACCTGATGGGA No data
Right 1171227523 20:23453561-23453583 AGAAGGAAGAAGCCACTGGTGGG No data
1171227511_1171227521 21 Left 1171227511 20:23453513-23453535 CCCATCCTGGGGACCTGATGGGA No data
Right 1171227521 20:23453557-23453579 TTAGAGAAGGAAGAAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171227511 Original CRISPR TCCCATCAGGTCCCCAGGAT GGG (reversed) Intergenic
No off target data available for this crispr