ID: 1171229839

View in Genome Browser
Species Human (GRCh38)
Location 20:23475490-23475512
Sequence CCTTGTTTGGAGATAACGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171229832_1171229839 3 Left 1171229832 20:23475464-23475486 CCAAAGTTATGTGACCTCCTGCT No data
Right 1171229839 20:23475490-23475512 CCTTGTTTGGAGATAACGGAGGG No data
1171229831_1171229839 12 Left 1171229831 20:23475455-23475477 CCTGCAGGTCCAAAGTTATGTGA No data
Right 1171229839 20:23475490-23475512 CCTTGTTTGGAGATAACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171229839 Original CRISPR CCTTGTTTGGAGATAACGGA GGG Intergenic
No off target data available for this crispr