ID: 1171232595

View in Genome Browser
Species Human (GRCh38)
Location 20:23499645-23499667
Sequence CAGGCTCAGGATTCACAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171232586_1171232595 7 Left 1171232586 20:23499615-23499637 CCAGGCAATTCATGTGGTCTTGG No data
Right 1171232595 20:23499645-23499667 CAGGCTCAGGATTCACAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171232595 Original CRISPR CAGGCTCAGGATTCACAGGG GGG Intergenic
No off target data available for this crispr