ID: 1171233045

View in Genome Browser
Species Human (GRCh38)
Location 20:23502543-23502565
Sequence TCTTATGTGCAGCAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171233045_1171233049 -8 Left 1171233045 20:23502543-23502565 CCTGCTTCCTGCTGCACATAAGA No data
Right 1171233049 20:23502558-23502580 ACATAAGATGATGCCTGCTGGGG No data
1171233045_1171233047 -10 Left 1171233045 20:23502543-23502565 CCTGCTTCCTGCTGCACATAAGA No data
Right 1171233047 20:23502556-23502578 GCACATAAGATGATGCCTGCTGG No data
1171233045_1171233052 28 Left 1171233045 20:23502543-23502565 CCTGCTTCCTGCTGCACATAAGA No data
Right 1171233052 20:23502594-23502616 TTCTGTCATCTATAACCAGGTGG No data
1171233045_1171233048 -9 Left 1171233045 20:23502543-23502565 CCTGCTTCCTGCTGCACATAAGA No data
Right 1171233048 20:23502557-23502579 CACATAAGATGATGCCTGCTGGG No data
1171233045_1171233051 25 Left 1171233045 20:23502543-23502565 CCTGCTTCCTGCTGCACATAAGA No data
Right 1171233051 20:23502591-23502613 TGCTTCTGTCATCTATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171233045 Original CRISPR TCTTATGTGCAGCAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr