ID: 1171235456

View in Genome Browser
Species Human (GRCh38)
Location 20:23520779-23520801
Sequence GTGTATCTTCAGAGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171235447_1171235456 21 Left 1171235447 20:23520735-23520757 CCTTTTAATCAGCAGTGCCAAGA 0: 1
1: 0
2: 2
3: 11
4: 157
Right 1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 206
1171235446_1171235456 25 Left 1171235446 20:23520731-23520753 CCTTCCTTTTAATCAGCAGTGCC 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 206
1171235452_1171235456 4 Left 1171235452 20:23520752-23520774 CCAAGAGGAGCTGGGGTGCCAGT 0: 1
1: 0
2: 0
3: 22
4: 266
Right 1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171235456 Original CRISPR GTGTATCTTCAGAGGCAGCA GGG Intergenic
900003939 1:31789-31811 GTGTATATTCACAGGCATCGTGG - Intergenic
900023663 1:202308-202330 GTGTATATTCACAGGCATCGTGG - Intergenic
900606932 1:3527916-3527938 GTGCATTTTCAGAGGGAGCGTGG - Intronic
901634115 1:10662804-10662826 GTATGTCTGCAGAGGCAGGAAGG - Intronic
901764761 1:11492667-11492689 GTGTTTCTTAGGGGGCAGCAGGG + Intronic
902217938 1:14946229-14946251 GTGTACCTTCAGAAGCTGCATGG + Intronic
903010817 1:20329204-20329226 GTGTAGCTTTTGAGCCAGCAAGG - Intronic
903337987 1:22637598-22637620 GTGTCTCCACAGAGGCATCATGG + Exonic
903696169 1:25208778-25208800 GTGTGTTTTGAGAAGCAGCAAGG - Intergenic
904484390 1:30815127-30815149 GTGTGTCCTCAGAGGCAGAAGGG - Intergenic
905768483 1:40622586-40622608 GTGTTTCTGCAGTGGCTGCAGGG - Exonic
906043303 1:42806282-42806304 CAGTGACTTCAGAGGCAGCAGGG + Intergenic
907811516 1:57875311-57875333 GAGCATGTTCAAAGGCAGCAAGG - Intronic
910179328 1:84463973-84463995 ATGCCTCATCAGAGGCAGCATGG + Intergenic
910293129 1:85617735-85617757 GTGTTCCTTCAGAAGCGGCAGGG - Intergenic
911068605 1:93814073-93814095 GTGTATCTTGTCAGGGAGCAGGG + Intronic
915928723 1:160044150-160044172 GAGAATGTTCAGAGGCAACAAGG + Intronic
916518359 1:165541187-165541209 ATGCAGCTTCAGATGCAGCATGG - Intergenic
917212223 1:172642871-172642893 GGATATCTTCAGACCCAGCAGGG + Intergenic
917341198 1:173979684-173979706 GTTTCTCTTCAGAGGTAGAAAGG + Intronic
917357535 1:174142515-174142537 GTTAATCTTCAAAAGCAGCAAGG + Intergenic
920527988 1:206683007-206683029 CTGCCTTTTCAGAGGCAGCAAGG - Intronic
921159659 1:212463952-212463974 GTGTTTATTCAGAAGCTGCAGGG + Intergenic
921356193 1:214286596-214286618 TTGTATCTTCAGAGGAGACAGGG - Intronic
921761760 1:218923307-218923329 GAGTATTTTCAGAGTCAGGAAGG + Intergenic
921764786 1:218958774-218958796 GGGGATCTTCATAGGCAGGAGGG - Intergenic
1063490483 10:6459318-6459340 GGGTTTCTTCAGAGGTAGAATGG - Intronic
1064262824 10:13799572-13799594 GGGCATTTTCAGAGGCAGGAAGG - Intronic
1065438672 10:25727135-25727157 GTGGACCTTCAGAGGGAGAAGGG - Intergenic
1065695258 10:28373720-28373742 GGGTCTCTTCAGAGGCTTCAGGG - Intergenic
1065918550 10:30371662-30371684 GTGTCTCTTCTGAGCCGGCAAGG + Intronic
1068013031 10:51478277-51478299 TTGTATCTTAAGATGCAGCCTGG + Intronic
1068086041 10:52374773-52374795 TGGTCTCTTCAGAGCCAGCAGGG + Intergenic
1073739830 10:106393849-106393871 TTGTACTTTCAGAGGGAGCATGG - Intergenic
1075056565 10:119223103-119223125 GGGTACCTTCAGAGGGAGCACGG - Intronic
1075815697 10:125263460-125263482 GTTTATCTTTAGAGGCATCCCGG + Intergenic
1076337271 10:129715993-129716015 GTGTAGCTTCTGAGGCCGCGTGG + Intronic
1077080106 11:721321-721343 CTCTATCTTCTGAGCCAGCACGG - Exonic
1078179235 11:8996744-8996766 GTGTATCTTGAAAGACAGGACGG - Intronic
1078820790 11:14879282-14879304 CTGCATCTTCAGAGGTTGCATGG + Exonic
1079980036 11:27141212-27141234 GGGTATCTTCAGTAGCAGCAAGG - Intergenic
1083771844 11:64871934-64871956 GTGGATCTGCAGACACAGCATGG - Intronic
1083990465 11:66243250-66243272 GGGACTCTTCAGTGGCAGCAAGG + Exonic
1088310798 11:108458422-108458444 GTCTTTGTTCAGAGTCAGCATGG + Intronic
1088729377 11:112667396-112667418 GTGTAGGTCCAGAGGCTGCAAGG - Intergenic
1089632348 11:119791681-119791703 TTGTACCTCCAGAGGCAGCCTGG + Intergenic
1089848308 11:121476073-121476095 GTATATCTTCAGGGGCACAAAGG - Intronic
1091377360 12:33840-33862 GTGTATATTCACAGGCATCGTGG - Intergenic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1098108773 12:67099416-67099438 GTGAAACTTCAGAGGCAGAAAGG + Intergenic
1101903141 12:108806521-108806543 GTGCATGTTCTCAGGCAGCAGGG + Intronic
1102070015 12:110010846-110010868 GCGTATCTTCAGAGACTGCAGGG + Intronic
1103294460 12:119874614-119874636 GTGTATCTTGAGAGGAATGAGGG + Intronic
1104064000 12:125291467-125291489 CTCCATCTTCAGAGCCAGCATGG - Intronic
1105211106 13:18257673-18257695 GTAAATCGTCAGAGGCAGAAAGG + Intergenic
1107343418 13:39434087-39434109 TTGCATGCTCAGAGGCAGCATGG + Intronic
1108176934 13:47801785-47801807 TTGTTTCTTCAAAGCCAGCAGGG + Intergenic
1108490451 13:50976229-50976251 CTGTATCTGAAGTGGCAGCAGGG + Intergenic
1108697039 13:52911524-52911546 GGGGATCTTGAGAGGCAGGACGG + Intergenic
1109688936 13:65860591-65860613 CTGTGTATTCAAAGGCAGCAGGG + Intergenic
1110179022 13:72593202-72593224 TTGTTTCTTCAAAGCCAGCAAGG - Intergenic
1110328683 13:74246637-74246659 GTGTTTCTGGAGAGGCATCACGG - Intergenic
1112390402 13:98978330-98978352 GTGGAGCTTAAGAGACAGCAAGG + Intronic
1116764982 14:49059452-49059474 GAGTATATTCAGAGGCAGACAGG + Intergenic
1117497880 14:56323739-56323761 GTTTCTCTAAAGAGGCAGCAGGG - Intergenic
1118978897 14:70700472-70700494 GTGTATCTTCAGCAGCCTCATGG - Intergenic
1120639504 14:86993235-86993257 ATGTGTCTTCAGAGTAAGCAAGG + Intergenic
1121267880 14:92616068-92616090 GGTTTTCTTCAGAGGCAGCAGGG - Intronic
1124254111 15:28127223-28127245 GTGTCTCTGCAGACGCAGCTGGG + Intronic
1125040753 15:35184669-35184691 GTTTATCTTCAGATGCAACTAGG + Intergenic
1126757358 15:51937565-51937587 AAGAATCTTCAGAGGCAGCATGG + Intronic
1127931189 15:63598584-63598606 GTTTTTCCTCAAAGGCAGCACGG - Intronic
1131407226 15:92175361-92175383 GTCTATCTTCCCAGGGAGCATGG - Intergenic
1131454605 15:92573347-92573369 GTCTAACTTCGGAGGCATCAAGG - Intergenic
1132449565 15:101959153-101959175 GTGTATATTCACAGGCATCGTGG + Intergenic
1132761324 16:1509881-1509903 GAGTCTCTGCAGAAGCAGCAGGG - Exonic
1133400242 16:5480486-5480508 GTGCATTTTCAGCGGCAGCAGGG - Intergenic
1133400331 16:5481430-5481452 GTGTATTTTCAGTGTCAGCAGGG + Intergenic
1135267421 16:21039621-21039643 GTGTATGTAAAGAGACAGCAGGG + Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135627638 16:24010128-24010150 GTCCAGCTTCAGAGCCAGCAGGG + Intronic
1138080140 16:54082800-54082822 GGGTTTCTTCTGAAGCAGCATGG - Intronic
1139799184 16:69507486-69507508 GTGTGTCTGCAGAGGCAACATGG - Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1142160380 16:88554512-88554534 CTCCATCTTCAGAGCCAGCAGGG + Intergenic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1142987257 17:3703658-3703680 ACGTGTCTTCAGAGGCTGCAGGG - Intergenic
1143692883 17:8585508-8585530 GTGGATCCTCAAAGGCACCATGG + Intronic
1144296017 17:13875839-13875861 GAGGTTCTTCAGAGGCAGCAAGG + Intergenic
1146386786 17:32383955-32383977 GTGTGTCTTCAGAAGCACCCAGG + Intergenic
1146626464 17:34438983-34439005 TTGAAACTTCAGATGCAGCAAGG - Intergenic
1149366605 17:55951670-55951692 GTATGTCTTCAGCAGCAGCATGG + Intergenic
1150251983 17:63711001-63711023 GGGTCCCTGCAGAGGCAGCAGGG - Intronic
1151628849 17:75296141-75296163 GTGGAGGTGCAGAGGCAGCAAGG - Intergenic
1152053320 17:77999819-77999841 TTGTTTCTTCAAAGCCAGCAGGG + Intergenic
1152313046 17:79562601-79562623 GTGTATTTTCAGAAGCTGCGGGG - Intergenic
1153985110 18:10344364-10344386 GTGCATGTTCAAAGACAGCATGG + Intergenic
1155517795 18:26640554-26640576 GTGTATGTGCAGATGCATCATGG - Intronic
1158687327 18:59626399-59626421 GGGTATTTTCAGGGGCAGGAGGG + Intronic
1160635691 19:73398-73420 GTGTATATTCACAGGCATCGTGG - Intergenic
1161056250 19:2191898-2191920 GTGTGTCTTCAGCAGCAGCGTGG + Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1166648877 19:44555147-44555169 CTGCATCTTCAAAGACAGCAAGG - Intergenic
1166846521 19:45731810-45731832 TTTTATTTTAAGAGGCAGCAGGG - Intergenic
1168646949 19:58065559-58065581 GTCCATCTTCACAGTCAGCAAGG + Intronic
925215840 2:2095324-2095346 GTTTATCTGGAGAGCCAGCAAGG + Intronic
927149454 2:20187383-20187405 GTGTATCTACAGATGCTCCAGGG - Intergenic
927878628 2:26675137-26675159 GTGAATCTTCAGAGGCTTCAGGG + Intergenic
932413198 2:71559221-71559243 GTGTAGCCCCAGACGCAGCACGG - Intronic
932423428 2:71614357-71614379 GTGAAACTACAGATGCAGCAAGG - Intronic
934688901 2:96342329-96342351 GTGTATCTAGAAAGGCAGCATGG + Intronic
935050930 2:99524482-99524504 CTCTATCTTCAAAGCCAGCAAGG - Intergenic
935801919 2:106706322-106706344 GTGAACCTTCAGAGGAAGAATGG - Intergenic
936565787 2:113581652-113581674 GTGTATATTCACAGGCATCGTGG + Intergenic
937269153 2:120636801-120636823 TTCTATCTTCAAAGCCAGCAAGG - Intergenic
938985697 2:136573225-136573247 CTATACCTTCAGAGGGAGCATGG + Intergenic
941344605 2:164352161-164352183 TAGCATCTTCAGAGGGAGCATGG - Intergenic
941547074 2:166864929-166864951 GAGTATATCCAAAGGCAGCAAGG + Intergenic
948091309 2:235298214-235298236 GTGTTTCTTCTGTGGCAACATGG + Intergenic
948643815 2:239391515-239391537 GTGTGTCCTCAGAGCCAGCGGGG + Intronic
1170313695 20:15019138-15019160 GTGTGTGTTCAGAGGAAGAAGGG - Intronic
1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG + Intergenic
1174220729 20:48952950-48952972 GTGATTCTTCACAGGCACCAAGG - Intronic
1174725959 20:52862311-52862333 GTTTATCTTCAGTGCCAGGATGG + Intergenic
1177028135 21:15947976-15947998 GTGTGTTTTCAAAGGCAGCAGGG - Intergenic
1179487831 21:41722283-41722305 GTGTATCTGCATAGGCAACCAGG - Intergenic
1179531662 21:42023674-42023696 TGGTGCCTTCAGAGGCAGCATGG - Intergenic
1181701658 22:24624703-24624725 GTAAATCATCAGAGGCAGAAAGG - Intronic
1182564407 22:31186643-31186665 GTGAATCTGCTGAGGCAGGAAGG - Intronic
1182990595 22:34763785-34763807 GTGTGTTTTGAGACGCAGCAAGG - Intergenic
1183962226 22:41418348-41418370 GTATCTCTGCAGAGACAGCAGGG - Intergenic
1184397022 22:44248380-44248402 GTGTGTCTACACTGGCAGCATGG + Exonic
950411160 3:12838546-12838568 GGGTATCTTCAGGGGCAGGAGGG - Intronic
950981403 3:17310184-17310206 GTGTATCTTCAGAGTCAAGAAGG - Intronic
951842472 3:27048890-27048912 GTGTATTTTCAGGGGCTGTAAGG - Intergenic
953373697 3:42410999-42411021 CTCTATCTTCAAAGCCAGCAAGG + Intergenic
954438563 3:50509087-50509109 GTGTAGCCTCACAGGCAGCATGG + Intergenic
954766493 3:52922286-52922308 GTGTATCATAAGAGGCAGTTAGG + Intronic
955490185 3:59474053-59474075 GTGAATATTGAGAGGCAGAAAGG - Intergenic
956239133 3:67109394-67109416 GTGTTTCTGCAGAAGCAACAAGG + Intergenic
959357529 3:105351711-105351733 GTGTATTTTCTGTGGCAGAAAGG + Intergenic
961541359 3:127601945-127601967 GTGTATCTTCAGAGAAATCCTGG + Intronic
962235881 3:133706675-133706697 GAGTTTCTTCTGAGGCAGGAGGG + Intergenic
962313438 3:134342215-134342237 TAGCATCTTCAGAGGGAGCATGG + Intergenic
962996448 3:140633470-140633492 TAGTACCTTCAGAGGAAGCATGG + Intergenic
967839890 3:193996785-193996807 GTCTCTCTTCATAGCCAGCACGG - Intergenic
968940016 4:3632899-3632921 CAGAACCTTCAGAGGCAGCACGG + Intergenic
969570580 4:8005972-8005994 GTGCATCTGCACAGGCAGCCTGG + Intronic
972025686 4:34373857-34373879 CTGTATCTGCAAAAGCAGCATGG - Intergenic
972416464 4:38845547-38845569 CTTTATCTTCAGGGCCAGCAAGG - Intronic
974310347 4:60199686-60199708 TTGCTTCTTCAGAGCCAGCAAGG - Intergenic
974684999 4:65216016-65216038 GGATGTCTTCAGTGGCAGCAAGG - Intergenic
974947246 4:68542983-68543005 GTGGATCTACAGAGGCAGGCAGG - Intronic
976564129 4:86533979-86534001 CTGTGTCTTTAGAGGCACCAGGG - Intronic
977027204 4:91834432-91834454 GGGTCTCTTCAGAGGCAGTGAGG + Intergenic
978337241 4:107682642-107682664 ATATATCTTCACAGGCAGCTTGG - Intronic
979660952 4:123254544-123254566 GTGTATCTACAGAGGCAATGTGG - Intronic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
981639822 4:146928186-146928208 GAGTATTTTCAGAGGCAGAATGG + Intronic
981748905 4:148074871-148074893 GTGTTCATTCAGAGGCAGTATGG + Intergenic
983416135 4:167457451-167457473 GAGACTCTTCACAGGCAGCAAGG - Intergenic
984416193 4:179461016-179461038 GTGTCTCTTGAATGGCAGCAGGG - Intergenic
984566060 4:181331363-181331385 GTCTCCCTTCAGAGGCTGCAAGG + Intergenic
986293680 5:6420187-6420209 TGGCATCTTCAGAGGGAGCATGG - Intergenic
988492941 5:31720453-31720475 GTGAATCTTCAGAGGCAAAGGGG - Intronic
989702961 5:44292791-44292813 GTGTTTCTTCAGAGACATCCAGG + Intergenic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
992286715 5:75242998-75243020 ATGTTTCTTCAGAAGCAGAAAGG + Intergenic
992751647 5:79868085-79868107 TAGCACCTTCAGAGGCAGCACGG - Intergenic
993475432 5:88358404-88358426 GAGTAACTTCTGAGGGAGCATGG - Intergenic
994261676 5:97666474-97666496 CAGTATCTGCAAAGGCAGCACGG + Intergenic
995166487 5:109049472-109049494 TTCTATCTTCAAAGTCAGCACGG + Intronic
995225021 5:109691031-109691053 CTCTCTCTTCAGAGGCAGCGGGG - Intronic
995503969 5:112839616-112839638 GTTTATCTTCAGAATCAGCCAGG + Exonic
997506963 5:134425319-134425341 GTGAATCTTCAGAGGGTGAAGGG + Intergenic
998046801 5:138993617-138993639 CTGCTTCTTCAGAGCCAGCAAGG - Intronic
998652061 5:144131877-144131899 GGGGCTCTTCAGAAGCAGCAGGG - Intergenic
1000212032 5:159116248-159116270 CTTTCTCTTGAGAGGCAGCATGG - Intergenic
1001169392 5:169404375-169404397 ATGTTTCTTCACAGGCAGCCAGG + Intergenic
1003254671 6:4464474-4464496 CTGTGCCTTCAGAGGAAGCATGG + Intergenic
1003424835 6:5991879-5991901 CTCTATCTTCAAAGCCAGCAAGG + Intergenic
1004523178 6:16381411-16381433 GAGCATCTTCACAGGGAGCATGG + Intronic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1007750648 6:44068689-44068711 GGGTCTCAGCAGAGGCAGCAGGG + Intergenic
1009003398 6:57749055-57749077 ATGTGTCTTCAGAGGCATAAGGG - Intergenic
1009031965 6:58070076-58070098 GTGAATCTTCAGAGGGTGAAGGG - Intergenic
1009207792 6:60824528-60824550 GTGAATCTTCAGAGGGTGAAGGG - Intergenic
1009370736 6:62898386-62898408 GTGTCTCTTCAGAGTCTGCCAGG + Intergenic
1013642636 6:112101728-112101750 GTATATTTTCAGAAGCAGCAAGG - Exonic
1015026173 6:128535473-128535495 GAGTATCTTTAGAGGTAGCAAGG + Intergenic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1016653124 6:146485725-146485747 GTGTACCTGAAGAGGCAGCTGGG - Intergenic
1018411959 6:163558705-163558727 GTGTGTCTTAAGAGACAACAGGG - Intronic
1019890745 7:3943915-3943937 AGGTAGCTTCAGAGGCAGAAAGG - Intronic
1019911301 7:4101979-4102001 TTGGATCTTCAGAGGCAGAAGGG - Intronic
1022443517 7:30452183-30452205 GTGAGCCTTCAAAGGCAGCACGG + Exonic
1024339289 7:48240867-48240889 GTGTTTGTTCAGTGGCAACAGGG + Exonic
1026395035 7:69943372-69943394 ATTTAGCTTCAGAGGCAGTATGG + Intronic
1029531181 7:101126438-101126460 GTGTATCATCGGAGGCGGCCGGG + Intergenic
1030908392 7:115214638-115214660 TTGTATATTCAAAGCCAGCAGGG + Intergenic
1031822892 7:126526822-126526844 GTGAAGATTCAGAGGAAGCATGG - Intronic
1033261861 7:139850888-139850910 TCGTGTCTTCAGAGGGAGCATGG + Intronic
1033620110 7:143054464-143054486 GTTTAACTCCAAAGGCAGCATGG - Intergenic
1033945345 7:146709788-146709810 GTGTATCTTGAGAGGCATACTGG + Intronic
1034240498 7:149607025-149607047 GTGTATCTGCGGAAGCAGAAGGG - Intergenic
1038663804 8:29520156-29520178 CTGTATCTTCAAAGCCAGCGAGG - Intergenic
1040716314 8:50257182-50257204 GTGTATGTTCAGTGGGAGAAGGG - Intronic
1041389509 8:57336379-57336401 GTGTTTCTTCAGAGGGAACTGGG - Intergenic
1041458311 8:58084086-58084108 GTGTATCTTCAGAAGTTACAAGG + Intronic
1042100767 8:65272788-65272810 CTCTGTCTTCAGTGGCAGCAGGG - Intergenic
1042251101 8:66757044-66757066 TTGAATCTTCAGGGGCAGAAAGG - Intronic
1043792896 8:84495813-84495835 GTGTCTCTTCAGATGTAACAAGG + Intronic
1047377649 8:124317808-124317830 CTGCATCTTCAGAGCCAGCAAGG - Intronic
1048351265 8:133618630-133618652 GTGGAACTCCAGAGGAAGCAGGG + Intergenic
1049404847 8:142447750-142447772 GGGGATCCTCAGAGGCAGCCCGG + Intergenic
1049886633 9:31571-31593 GTGTATATTCACAGGCATCGTGG - Intergenic
1055483966 9:76738733-76738755 GTGTATGCTCAGAGACATCATGG + Intronic
1059413837 9:114151125-114151147 GTGGGTCTTCAGAAGCAGCTTGG + Intergenic
1060260780 9:122071832-122071854 GTCAATCTGCAGAGACAGCAAGG - Intronic
1186813135 X:13209491-13209513 GAGTATCTTCCCAGGCAGTATGG - Intergenic
1188570518 X:31579984-31580006 CTCTATCTTCAAAGCCAGCAGGG + Intronic
1189257075 X:39648636-39648658 GAGTGTCTTCAGAGGGAGCCAGG - Intergenic
1190004428 X:46721588-46721610 GGTTATCTTCAGATGCTGCATGG + Intronic
1192993544 X:76488145-76488167 TTGAGTCTACAGAGGCAGCATGG + Intergenic
1194041030 X:88942175-88942197 ATGAATCTTCAGAGGCAAAAAGG - Intergenic
1195170364 X:102261450-102261472 GTCTATCTCCAGATGCTGCAGGG - Intergenic
1195188495 X:102425650-102425672 GTCTATCTCCAGATGCTGCAGGG + Intronic
1198038797 X:132828194-132828216 GTGTTTCTTTAAAGTCAGCATGG + Intronic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1199900637 X:152168629-152168651 GAGAACCTTCAGAGGCTGCAGGG + Intronic
1200279133 X:154762067-154762089 GGGTATCATGATAGGCAGCAGGG - Intergenic