ID: 1171238414

View in Genome Browser
Species Human (GRCh38)
Location 20:23546384-23546406
Sequence CAGGGTCAAGAGAAGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171238408_1171238414 8 Left 1171238408 20:23546353-23546375 CCTTCTCTGAGCTTCCTTCTGCT No data
Right 1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG No data
1171238412_1171238414 -6 Left 1171238412 20:23546367-23546389 CCTTCTGCTGATGGAGTCAGGGT No data
Right 1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171238414 Original CRISPR CAGGGTCAAGAGAAGGACCA AGG Intergenic
No off target data available for this crispr