ID: 1171240900

View in Genome Browser
Species Human (GRCh38)
Location 20:23566317-23566339
Sequence ATGCACTTCCCACTCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171240894_1171240900 14 Left 1171240894 20:23566280-23566302 CCAGGGCAGACACCCATGAATGT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG 0: 1
1: 0
2: 1
3: 14
4: 222
1171240895_1171240900 2 Left 1171240895 20:23566292-23566314 CCCATGAATGTATCCCTATTTCC 0: 1
1: 0
2: 0
3: 8
4: 197
Right 1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG 0: 1
1: 0
2: 1
3: 14
4: 222
1171240896_1171240900 1 Left 1171240896 20:23566293-23566315 CCATGAATGTATCCCTATTTCCA 0: 1
1: 0
2: 2
3: 13
4: 276
Right 1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG 0: 1
1: 0
2: 1
3: 14
4: 222
1171240892_1171240900 16 Left 1171240892 20:23566278-23566300 CCCCAGGGCAGACACCCATGAAT 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG 0: 1
1: 0
2: 1
3: 14
4: 222
1171240893_1171240900 15 Left 1171240893 20:23566279-23566301 CCCAGGGCAGACACCCATGAATG 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG 0: 1
1: 0
2: 1
3: 14
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171240900 Original CRISPR ATGCACTTCCCACTCTCCCA TGG Intronic
902619815 1:17644304-17644326 ACACACTTCACACTCTGCCAGGG - Intronic
906263419 1:44409907-44409929 AAGCACTCCCCCCTCCCCCATGG + Intronic
906546386 1:46622199-46622221 ATAAACCTCCCTCTCTCCCAGGG - Intergenic
907308772 1:53527803-53527825 CTGCACTTCCCAGGCTTCCAGGG + Intronic
907498605 1:54861818-54861840 ACTCATTTCCCACTCTCCGAGGG + Intronic
907805427 1:57814448-57814470 ATTCATTTGCCACTCTCTCAGGG + Intronic
908273387 1:62443277-62443299 ATGAACTTGCCACTCAGCCAAGG + Exonic
910549995 1:88464811-88464833 ATTAACTGCCCACTCTCACATGG + Intergenic
911875055 1:103150758-103150780 ATGCTCTACCCAATGTCCCATGG + Intergenic
912245208 1:107954761-107954783 ATGAATTTCCCCCCCTCCCATGG - Intronic
915892454 1:159784289-159784311 ATGCCCTTCCCTTCCTCCCAAGG + Intergenic
917219003 1:172707375-172707397 AGTCACTTCCCACTCACCCTTGG - Intergenic
918467073 1:184831504-184831526 ATGCACTTCGCACTATTCCTCGG + Intronic
919763774 1:201114012-201114034 ATGCACGCCCCCCTCCCCCAAGG + Exonic
920038556 1:203081611-203081633 TGGCACCTCCCACACTCCCAGGG - Intergenic
920804982 1:209224530-209224552 AATCACTTCCCACTGTTCCAGGG + Intergenic
921922678 1:220686616-220686638 ATGCCCTTCTCAATCTCCAAGGG - Intergenic
922065267 1:222131554-222131576 CTGCACTCCCTTCTCTCCCAGGG - Intergenic
922899015 1:229122059-229122081 AAGAACTCCCCACTCTCTCAGGG - Intergenic
923033394 1:230267466-230267488 ATGCCATTCCCAGGCTCCCAGGG + Intronic
923755873 1:236790815-236790837 ATGGACTTCCCGCTCAGCCAGGG + Intergenic
1063109111 10:3019698-3019720 ATGGAATTCCCAACCTCCCAGGG + Intergenic
1066578576 10:36853821-36853843 TTGCACTTCCTATGCTCCCATGG - Intergenic
1067081447 10:43214854-43214876 ATGCAATTCTCCCTCACCCAGGG + Intronic
1067994102 10:51250392-51250414 ACATACTTCCCACTTTCCCATGG - Intronic
1070320944 10:75354124-75354146 ATGCATTCTCCACTCTCCCTTGG + Intergenic
1070851164 10:79562565-79562587 GTGCCCTTCTCACTCTCCTAGGG + Intergenic
1070916491 10:80158406-80158428 ATGCACATTCCACTCAGCCACGG - Intronic
1072912239 10:99513469-99513491 ATTCCCTTTCCACTCTGCCATGG + Intergenic
1073045758 10:100637350-100637372 GTGCACTTCCCACTTCCTCAGGG - Intergenic
1073173690 10:101536138-101536160 AAGCACCTCCCCCTCTGCCACGG - Intronic
1073566251 10:104538084-104538106 ATGCCCCTCCCTCTCACCCAGGG + Intergenic
1075409402 10:122216189-122216211 CTCCACTTCCCACTCTCCAGTGG + Intronic
1075527879 10:123201562-123201584 ATGGAGTTCCCTCTCCCCCAGGG - Intergenic
1076252206 10:128993787-128993809 ATGCATTTGCCACTCTGCCCAGG + Intergenic
1076414536 10:130276361-130276383 AGGCACTTCCTACACTCTCAGGG - Intergenic
1077736774 11:4799936-4799958 GTGGACTTCCCAAGCTCCCAAGG - Intronic
1077854490 11:6108813-6108835 CTGCACTTACCACACTCCCTAGG + Exonic
1077898062 11:6468961-6468983 ATGCCCTTCACACTCTACCCAGG - Intronic
1079031464 11:16989239-16989261 CTGCTCTTCCCACTCTAACAAGG - Intronic
1079243972 11:18739908-18739930 ATGCACTTTCCACCCTCCACAGG - Intronic
1080601018 11:33820619-33820641 CAGCACTTCTCACTCCCCCAAGG + Intergenic
1081852121 11:46281199-46281221 CTGCCCCTCCCGCTCTCCCATGG + Intronic
1084155002 11:67308391-67308413 GTGCTGTTCCCTCTCTCCCAGGG + Exonic
1084688044 11:70708815-70708837 ATCATCTTCCCACTCTCCCGTGG - Intronic
1084689711 11:70718016-70718038 TTCCACTTCCCACTGTACCAGGG + Intronic
1084929127 11:72540122-72540144 ACTCACTTCCCACACTCCCTTGG - Intergenic
1085322588 11:75583845-75583867 AGCCACTTCCCAGTCTCCCGCGG - Intergenic
1087887602 11:103498055-103498077 GTGCACTCCCCTCTCACCCAGGG - Intergenic
1088919912 11:114253247-114253269 ATGCCCTTCCCACTCAGCCTGGG + Intergenic
1089367646 11:117931064-117931086 CTCCTCTTCCCTCTCTCCCAGGG + Intergenic
1090777125 11:129975540-129975562 ATGACCATCCCACTCCCCCATGG + Intronic
1093925067 12:24902073-24902095 CTGCACTTCCCACCCTGCCGGGG + Intronic
1095074721 12:37904242-37904264 ATGCACTCCCAAATATCCCATGG + Intergenic
1097455378 12:59792980-59793002 ATGGATTTCCCACTTTGCCAAGG + Intergenic
1098638697 12:72815019-72815041 ATGCACTTCCTCCTCAGCCAGGG - Intergenic
1100826003 12:98475101-98475123 TTGCACATCCTCCTCTCCCAGGG + Intergenic
1101236948 12:102799345-102799367 ATCCACTGCCCAGTCCCCCAAGG - Intergenic
1101583264 12:106062883-106062905 AGGCACTCCCCTCTATCCCAAGG - Intergenic
1104720756 12:131043878-131043900 GTGCACTTCCCACTCATCCCAGG - Intronic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1106004654 13:25757351-25757373 ATGCACTTGCCACTGTGCCCTGG + Intronic
1107117637 13:36764090-36764112 ATACACCTTCCACTCTACCATGG - Intergenic
1107608679 13:42089995-42090017 ATGCACTTCCAAATAACCCATGG + Intronic
1110698804 13:78523135-78523157 ATGAACTTCACCCTTTCCCAAGG + Intergenic
1112079643 13:95955389-95955411 TTGCATTTCCCACTCTCACTAGG - Intronic
1112448273 13:99487006-99487028 CTGCTCTGCCCACTCTCACATGG - Intergenic
1113648857 13:112019374-112019396 ATGAACTTCCCAAGTTCCCATGG + Intergenic
1114415129 14:22537764-22537786 ATGTCCTTCCCCCGCTCCCATGG - Intergenic
1114494922 14:23126037-23126059 ATGCTCTCCTCAGTCTCCCAGGG + Exonic
1114536187 14:23424393-23424415 ATGCAATTCCCACCCTTCGATGG - Intronic
1116493885 14:45537212-45537234 ATGGACCTCCCACTTTGCCAGGG + Intergenic
1121828471 14:97029653-97029675 GTTCACTTTCCACTTTCCCAAGG + Intergenic
1122476284 14:102011929-102011951 ATGCTCTTCCCACTTCCCGAGGG - Exonic
1122937839 14:104968120-104968142 ATGCCCTTCCCCCACTCCCCGGG + Intronic
1126914722 15:53453137-53453159 ATGCACTTCTCACTCTACTGAGG - Intergenic
1127382293 15:58440571-58440593 AAGGACTTCCCACTGTGCCAGGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128546898 15:68574393-68574415 ATGCAGCACCCACTCACCCATGG + Intergenic
1129159805 15:73740891-73740913 AAGCAGTTCCCTCTCCCCCAGGG - Intronic
1129832796 15:78681710-78681732 GTGTACTTCCCATTCCCCCATGG + Intronic
1131052860 15:89359744-89359766 ATGCACGTTCCAGGCTCCCAGGG - Intergenic
1132635628 16:944633-944655 CTGCACCTGCCACTCTGCCATGG + Intronic
1133097898 16:3459593-3459615 ATGCACGCCCCATTCTCCAAGGG - Intronic
1133340133 16:5030636-5030658 CTGCACATCCCAGTCTCCCCAGG + Intronic
1133986922 16:10675832-10675854 AAGCAGTACCCTCTCTCCCAAGG - Intronic
1134148126 16:11784027-11784049 CTGCACTTCTCACCCTCCCCTGG - Intronic
1134237178 16:12475951-12475973 TTGTACTTGCCACTCTCCAAGGG + Intronic
1134608727 16:15591170-15591192 ATCCACTGCCCACGGTCCCAGGG + Intronic
1135379848 16:21986689-21986711 ATGGAGTTCACATTCTCCCAGGG + Intronic
1139456156 16:67079019-67079041 ATGCTGTTCCCAATTTCCCACGG - Intronic
1140300824 16:73755900-73755922 AGGCACTCGCCCCTCTCCCACGG + Intergenic
1141188564 16:81806972-81806994 ATCCACTGCAAACTCTCCCATGG - Intronic
1143932003 17:10438727-10438749 ATTCAATTACCTCTCTCCCATGG + Intergenic
1144679048 17:17180695-17180717 ATGCACTGCTCACACCCCCATGG + Intronic
1151807699 17:76416778-76416800 TTGCACCTCCATCTCTCCCAAGG + Intronic
1152379376 17:79934525-79934547 AAGCACCTCCCACTCCCACATGG + Exonic
1152618427 17:81348557-81348579 ATCCCCCTCCCACTGTCCCAGGG - Intergenic
1152822762 17:82445606-82445628 CTGCTCCTCCCACTCTCCCCAGG + Intronic
1154102603 18:11489877-11489899 AGGGACTTCCCTATCTCCCAGGG + Intergenic
1157096374 18:44688976-44688998 ATACACTGCCCACTCTCCCAGGG - Intronic
1157150100 18:45208140-45208162 ATGCACTTCTCACAAGCCCATGG + Intergenic
1157518378 18:48327518-48327540 CTGCTCATCCCACCCTCCCAGGG + Intronic
1157535655 18:48455634-48455656 TTCCCCTTCCCACTCTGCCAAGG + Intergenic
1158664387 18:59419532-59419554 TTTCACTTTTCACTCTCCCATGG + Intergenic
1158934566 18:62352761-62352783 CTGCAGTGCCCACTCTTCCAAGG - Intronic
1160305337 18:77728765-77728787 ATTCACTTACCACTCCCCCAGGG + Intergenic
1161668115 19:5589394-5589416 AGGCACTTCCAGCTCTGCCAGGG - Intronic
1162353685 19:10167084-10167106 CTTCACCTCCCACTCTGCCAGGG + Intronic
1163821656 19:19499611-19499633 ATGCTCTCCCCACTCTCTTAGGG + Intronic
1165162031 19:33822110-33822132 ACCCACTTCCCACCCTCCCCAGG + Intergenic
1166621547 19:44305893-44305915 GTTCACTTCTCCCTCTCCCAGGG + Intergenic
1167298734 19:48667087-48667109 ATCCAGATCCCTCTCTCCCAGGG + Intronic
925451146 2:3969996-3970018 AGGCACTGCCCACCCTCACAGGG + Intergenic
926951642 2:18249592-18249614 ATGCCCTTCCCAGTCTGCCCAGG - Intronic
927462363 2:23310110-23310132 ATCCCCCTCCCAATCTCCCAGGG + Intergenic
928092593 2:28384669-28384691 ATTCAATCCCAACTCTCCCAGGG + Intergenic
929208633 2:39327791-39327813 ATGCATTTCCCACTCCACTAGGG - Intronic
929281821 2:40088070-40088092 TTGCACTTCCCAGTCTGGCAAGG - Intergenic
930700976 2:54457171-54457193 CTGCCGTCCCCACTCTCCCAGGG + Intronic
931973434 2:67615945-67615967 AAGCACCTCACACTCACCCAAGG - Intergenic
933186936 2:79289402-79289424 ATTCACTTTCCAGTTTCCCATGG + Intronic
933698894 2:85240266-85240288 CTGCACCTCCCTCTCTCACAAGG + Intronic
934055767 2:88250232-88250254 AGGCCCTTCCCTCTGTCCCAGGG + Intergenic
934942201 2:98510769-98510791 ATGCACATCCCAGACTCCAATGG - Intronic
935391911 2:102561777-102561799 ATGCCCTTCCCACTGTCCTAAGG + Intergenic
936608999 2:113983244-113983266 ATGCACTTAACACTCTCTCCCGG + Intergenic
940103956 2:150076328-150076350 ATGATCTTTCCACTCTCACATGG + Intergenic
944815774 2:203373671-203373693 GTGCTCTTCCCACCTTCCCAAGG + Intronic
947219894 2:227781992-227782014 AGGCATTTCCCACTCTTCCGTGG - Intergenic
947610657 2:231522991-231523013 ATGCAAGTCCTACTCCCCCAGGG + Intergenic
948178512 2:235962168-235962190 ACCCACTTCCCACTCTCCAAGGG - Intronic
1171088485 20:22261911-22261933 TTGCTCTTCCCACTCACCCCAGG + Intergenic
1171240900 20:23566317-23566339 ATGCACTTCCCACTCTCCCATGG + Intronic
1172047580 20:32091558-32091580 ATAAATTTCCCACACTCCCAGGG + Intronic
1172796205 20:37540307-37540329 ATGGACTTCCCCCTCAGCCAGGG - Intergenic
1173818559 20:46006173-46006195 CTGCCCCTCCCACTCACCCAGGG + Intergenic
1174228050 20:49020874-49020896 ATCCACCTCCCATTCCCCCAGGG + Intronic
1175277082 20:57779545-57779567 ATGGACTTTCCAGTCTCCAAAGG - Intergenic
1175498663 20:59433656-59433678 TCTCCCTTCCCACTCTCCCAGGG - Intergenic
1176055669 20:63146229-63146251 ATGCACTTCTGAATATCCCATGG - Intergenic
1176132168 20:63500750-63500772 ATGCCCACCCCACTCCCCCAAGG + Intergenic
1177948163 21:27499490-27499512 ATGCATTTTACAATCTCCCAAGG - Intergenic
1179248353 21:39652238-39652260 CCACACTTCCCACTCTCCCTGGG + Intronic
1179955141 21:44734371-44734393 TTGCTCTTCCCTCTCACCCAGGG - Intergenic
1180867250 22:19126697-19126719 ATGCGACTCCCACTCCCCCAGGG + Intergenic
1181582003 22:23833772-23833794 TTGCCTTTCCCAGTCTCCCATGG + Intronic
1184187218 22:42872746-42872768 ACGCATGTCCCACCCTCCCAGGG - Intronic
1185334322 22:50264846-50264868 AGGCACCTCCCACACTCCTATGG - Exonic
949841216 3:8322134-8322156 ATGCACTGTCCACCTTCCCAGGG - Intergenic
950705841 3:14780983-14781005 TTACACTTCCCATTCTCCCATGG + Intergenic
952010867 3:28899693-28899715 ATTCACTTGCCACTCACACAAGG - Intergenic
953436652 3:42882503-42882525 CTGCCCTCCCCACCCTCCCAAGG - Intronic
953666561 3:44930012-44930034 ATGCACTGCCCCCGCTCCCAGGG + Intronic
955327745 3:58022109-58022131 ATGGCCTTCTTACTCTCCCACGG + Intronic
958045642 3:88280711-88280733 TTGCACTTTCCACTCTCCTAAGG - Intergenic
958199529 3:90292457-90292479 ATGCACTTCCAAATATCCCTTGG + Intergenic
959037489 3:101383989-101384011 GTGCACTTCCTACCCTCCAAAGG + Intronic
964361879 3:155907339-155907361 ATCCACTTTCCAGTCTCCCAAGG - Intronic
964633510 3:158837322-158837344 CTGCACTGCTGACTCTCCCATGG - Intergenic
964721683 3:159773213-159773235 ATGCACTTTCTACTGTCACAGGG + Intronic
967826472 3:193881620-193881642 ATGCCCTTCCCACTTCCCCAGGG + Intergenic
968582008 4:1399542-1399564 CTGCACTTCCCAGCCTCCCTTGG + Intergenic
968923880 4:3536832-3536854 ATGGACTTCCTCCTCTGCCAGGG + Intergenic
969918165 4:10510512-10510534 ATGGACTTCCTCCTCTGCCAGGG + Intronic
970005469 4:11406667-11406689 ATGCACTCCCCACTGCCCAAGGG - Intronic
970846384 4:20543312-20543334 CTGCACTGCCCACGCTCCCTTGG + Intronic
972197453 4:36671385-36671407 CTGCCTTTCCCACTCTCCCAAGG - Intergenic
972355263 4:38274557-38274579 ATCCACTCCCCTGTCTCCCAGGG - Intergenic
977551427 4:98447811-98447833 AAGCCCTCCCCACTCTCCCGAGG + Intergenic
978606771 4:110489173-110489195 AAGCACTTCCCACTCACCAAAGG - Intronic
978778017 4:112521789-112521811 ATGGGCTGCCCACTCTCCAATGG + Intergenic
981557408 4:146009806-146009828 ATGCTCTGCAGACTCTCCCAAGG - Intergenic
984879963 4:184402040-184402062 TTGCACCTCCCAGCCTCCCAGGG + Intronic
987867099 5:23557524-23557546 TTACACTTCTCATTCTCCCAGGG - Intergenic
988903285 5:35756789-35756811 ATACACTTGTCAATCTCCCAGGG - Intronic
988907155 5:35801572-35801594 CTGCATTTGCCACTTTCCCAGGG + Intronic
989281952 5:39654818-39654840 ATGCACATGCCATTCTTCCAAGG + Intergenic
990307865 5:54510708-54510730 ATTCACATCCCTCTCTGCCACGG - Intergenic
990642974 5:57809117-57809139 ATGAACTTCCTACACACCCAAGG - Intergenic
990779164 5:59338709-59338731 ATGCACTTTCCAAGTTCCCAGGG + Intronic
992453443 5:76893970-76893992 ATGGACTTCCTCCTCACCCAGGG + Intronic
992678869 5:79133479-79133501 AAGCACTTCTCACTATTCCAAGG + Intronic
993480124 5:88414566-88414588 AAACATTGCCCACTCTCCCAGGG - Intergenic
994275472 5:97832057-97832079 ATGCACTTCAAACTCTTTCAAGG - Intergenic
997166815 5:131669473-131669495 AAGCAATTCCCACTCTGTCATGG - Intronic
999647951 5:153737891-153737913 AGGCATTTTTCACTCTCCCAGGG + Intronic
1003458098 6:6302608-6302630 ATTCACTCACCACTCACCCAGGG - Intronic
1004301135 6:14458469-14458491 ATGCTCTTCCTTCTCTCCAAAGG + Intergenic
1005029462 6:21495154-21495176 AGGCAATTCTTACTCTCCCAAGG - Intergenic
1005181609 6:23113460-23113482 ATATACTTCCCTCTTTCCCAGGG + Intergenic
1005627518 6:27677299-27677321 ATGCACTTCCCATTTTCTCCAGG + Intergenic
1005788207 6:29269000-29269022 ATGAACCTCCAACTCTGCCAGGG - Intergenic
1009696636 6:67113842-67113864 ATGTATTTCCCAGTCTTCCAAGG + Intergenic
1009923709 6:70095065-70095087 AGTCACTTTCCACTCTCACATGG + Intronic
1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG + Intergenic
1011801037 6:91016650-91016672 AGGCAATTGCCACTCTCACATGG + Intergenic
1012487792 6:99741740-99741762 ATGCTCTTCCCACCCTTCCCGGG - Intergenic
1012910587 6:105113288-105113310 ATTCACTTGCCCCTCTTCCATGG - Intronic
1013475955 6:110507516-110507538 ATGGACTTCCTACTCAGCCAGGG + Intergenic
1014553264 6:122813739-122813761 CTGCCCTTCACACTCTCCCCAGG - Intergenic
1014716347 6:124868788-124868810 ATACTCTTCCCACTGTGCCAAGG - Intergenic
1018316585 6:162562444-162562466 GTGGACTTCCCACTGGCCCAGGG - Intronic
1018737169 6:166696041-166696063 CTGCACTCCCCCCTCTTCCACGG + Intronic
1020242438 7:6406105-6406127 ACGTACTTCCAACTCTCTCAAGG - Intergenic
1022300764 7:29100153-29100175 CTGCTCTTCCCAGCCTCCCAGGG + Intronic
1024598689 7:50961416-50961438 ATATCCTTCCCAATCTCCCAGGG - Intergenic
1029539307 7:101173429-101173451 ACGCCCTTCCCGCGCTCCCAGGG + Exonic
1029797677 7:102912037-102912059 CTGTATTTCCCACTATCCCAGGG + Intronic
1030283866 7:107804782-107804804 ATGCACTTCTCTCTCTCTCTCGG + Intergenic
1032016659 7:128384272-128384294 CTGCCCCTCCCACTCTCCCGGGG - Intergenic
1036727046 8:11229832-11229854 CTGAAATTCCCACTCTCACAGGG + Intergenic
1040392696 8:46963090-46963112 ATGCACTGCCCCCTCTCACCCGG + Intergenic
1040517158 8:48144523-48144545 ATTTTCTGCCCACTCTCCCACGG - Intergenic
1040976047 8:53195463-53195485 ATGCAGGACCCACTCTGCCAAGG + Intergenic
1042075469 8:64989112-64989134 ATGCACTTTCCACTGCCCCAGGG + Intergenic
1045385650 8:101668714-101668736 ATGCACTTCCCATGCTCCTAGGG + Exonic
1045684170 8:104694028-104694050 AAGCACTTCCCTCCCTCGCAGGG - Intronic
1046133259 8:109994491-109994513 ATGGACTTCCCCCTCGACCAGGG + Intergenic
1047528473 8:125654345-125654367 ATGCACTTGGCCCTCTCTCAGGG - Intergenic
1047712624 8:127567603-127567625 AGGCACTTCCTTCTCTGCCAAGG + Intergenic
1048982753 8:139711878-139711900 TAGCACTTCCCACTGTCCCCTGG + Intergenic
1049240990 8:141537246-141537268 AAGGACTTCCCAGACTCCCAGGG - Intergenic
1050670718 9:7993842-7993864 ATACTCTTCCCACTGTGCCAGGG - Intergenic
1052693945 9:31852810-31852832 ATGGTCTTTTCACTCTCCCAAGG + Intergenic
1054465364 9:65490245-65490267 ATGGACTTCCTCCTCTGCCAGGG - Intergenic
1056775290 9:89507868-89507890 ATGAACTTCCTCCTCTGCCAGGG - Intergenic
1057689976 9:97275312-97275334 ATGAACTTCCCACCCTTCCAGGG - Intergenic
1058948978 9:109885567-109885589 ATTTACTTCCCACTCTCCTTGGG - Intronic
1059927021 9:119219817-119219839 AAGCACTCTCCACTCTCCTAGGG + Intronic
1187519027 X:19997524-19997546 CTCCAATTCCCACTCTCCCTTGG + Intergenic
1187680594 X:21763792-21763814 TGGCACTACCCACCCTCCCAAGG + Intergenic
1189059622 X:37738666-37738688 CTTCACATCCCACCCTCCCATGG + Intronic
1189567737 X:42260910-42260932 ATTTCCTTCCCAGTCTCCCAAGG + Intergenic
1194233733 X:91356851-91356873 AAGAACTTCCAAGTCTCCCATGG - Intergenic
1194522066 X:94931468-94931490 ATGGGCTTCCCTCTGTCCCACGG + Intergenic
1198365171 X:135932745-135932767 ATGCAATTCCTAATCTCTCAAGG + Intergenic
1199431440 X:147765173-147765195 ATACACTGGCAACTCTCCCAAGG + Intergenic