ID: 1171243131

View in Genome Browser
Species Human (GRCh38)
Location 20:23587462-23587484
Sequence GCAGGTACACCCCTGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171243126_1171243131 4 Left 1171243126 20:23587435-23587457 CCGTGTAATTGGAGCTCCTCCAG No data
Right 1171243131 20:23587462-23587484 GCAGGTACACCCCTGTGGTGTGG No data
1171243123_1171243131 27 Left 1171243123 20:23587412-23587434 CCCAGATTGGCTAGTGGCTTTCT No data
Right 1171243131 20:23587462-23587484 GCAGGTACACCCCTGTGGTGTGG No data
1171243124_1171243131 26 Left 1171243124 20:23587413-23587435 CCAGATTGGCTAGTGGCTTTCTC No data
Right 1171243131 20:23587462-23587484 GCAGGTACACCCCTGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171243131 Original CRISPR GCAGGTACACCCCTGTGGTG TGG Intergenic
No off target data available for this crispr