ID: 1171243252

View in Genome Browser
Species Human (GRCh38)
Location 20:23588043-23588065
Sequence CAGGGTCAAGAGAAGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171243252_1171243254 -6 Left 1171243252 20:23588043-23588065 CCTTGGTCCTTCTCTTGACCCTG No data
Right 1171243254 20:23588060-23588082 ACCCTGACTCCATCAGCAGAAGG No data
1171243252_1171243258 5 Left 1171243252 20:23588043-23588065 CCTTGGTCCTTCTCTTGACCCTG No data
Right 1171243258 20:23588071-23588093 ATCAGCAGAAGGAAGCTCAGAGG No data
1171243252_1171243259 8 Left 1171243252 20:23588043-23588065 CCTTGGTCCTTCTCTTGACCCTG No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171243252 Original CRISPR CAGGGTCAAGAGAAGGACCA AGG (reversed) Intergenic
No off target data available for this crispr