ID: 1171243259

View in Genome Browser
Species Human (GRCh38)
Location 20:23588074-23588096
Sequence AGCAGAAGGAAGCTCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171243244_1171243259 28 Left 1171243244 20:23588023-23588045 CCTCCCCTGTCTGCTCCCACCCT No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243255_1171243259 -10 Left 1171243255 20:23588061-23588083 CCCTGACTCCATCAGCAGAAGGA No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243251_1171243259 9 Left 1171243251 20:23588042-23588064 CCCTTGGTCCTTCTCTTGACCCT No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243249_1171243259 13 Left 1171243249 20:23588038-23588060 CCCACCCTTGGTCCTTCTCTTGA No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243250_1171243259 12 Left 1171243250 20:23588039-23588061 CCACCCTTGGTCCTTCTCTTGAC No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243247_1171243259 24 Left 1171243247 20:23588027-23588049 CCCTGTCTGCTCCCACCCTTGGT No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243253_1171243259 1 Left 1171243253 20:23588050-23588072 CCTTCTCTTGACCCTGACTCCAT No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243248_1171243259 23 Left 1171243248 20:23588028-23588050 CCTGTCTGCTCCCACCCTTGGTC No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243252_1171243259 8 Left 1171243252 20:23588043-23588065 CCTTGGTCCTTCTCTTGACCCTG No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data
1171243245_1171243259 25 Left 1171243245 20:23588026-23588048 CCCCTGTCTGCTCCCACCCTTGG No data
Right 1171243259 20:23588074-23588096 AGCAGAAGGAAGCTCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171243259 Original CRISPR AGCAGAAGGAAGCTCAGAGG AGG Intergenic
No off target data available for this crispr