ID: 1171243413

View in Genome Browser
Species Human (GRCh38)
Location 20:23589234-23589256
Sequence CTAGCTCTGTGTCTTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171243411_1171243413 -6 Left 1171243411 20:23589217-23589239 CCCAGCTGTCGGTGGTTCTAGCT No data
Right 1171243413 20:23589234-23589256 CTAGCTCTGTGTCTTGTGTCTGG No data
1171243410_1171243413 0 Left 1171243410 20:23589211-23589233 CCACATCCCAGCTGTCGGTGGTT No data
Right 1171243413 20:23589234-23589256 CTAGCTCTGTGTCTTGTGTCTGG No data
1171243412_1171243413 -7 Left 1171243412 20:23589218-23589240 CCAGCTGTCGGTGGTTCTAGCTC No data
Right 1171243413 20:23589234-23589256 CTAGCTCTGTGTCTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171243413 Original CRISPR CTAGCTCTGTGTCTTGTGTC TGG Intergenic
No off target data available for this crispr