ID: 1171247697

View in Genome Browser
Species Human (GRCh38)
Location 20:23625912-23625934
Sequence CTGGGGGCACAGAATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171247697_1171247706 6 Left 1171247697 20:23625912-23625934 CCAGCCTCATTCTGTGCCCCCAG No data
Right 1171247706 20:23625941-23625963 GGACCACAGTCTTAGCAACTGGG No data
1171247697_1171247705 5 Left 1171247697 20:23625912-23625934 CCAGCCTCATTCTGTGCCCCCAG No data
Right 1171247705 20:23625940-23625962 AGGACCACAGTCTTAGCAACTGG No data
1171247697_1171247708 11 Left 1171247697 20:23625912-23625934 CCAGCCTCATTCTGTGCCCCCAG No data
Right 1171247708 20:23625946-23625968 ACAGTCTTAGCAACTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171247697 Original CRISPR CTGGGGGCACAGAATGAGGC TGG (reversed) Intergenic
No off target data available for this crispr