ID: 1171249436

View in Genome Browser
Species Human (GRCh38)
Location 20:23637346-23637368
Sequence CTCGAGCTGCGCCGCAGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171249436_1171249442 8 Left 1171249436 20:23637346-23637368 CCCGCGCTGCGGCGCAGCTCGAG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 65
1171249436_1171249443 9 Left 1171249436 20:23637346-23637368 CCCGCGCTGCGGCGCAGCTCGAG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1171249436_1171249440 2 Left 1171249436 20:23637346-23637368 CCCGCGCTGCGGCGCAGCTCGAG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1171249440 20:23637371-23637393 GGCTCCTGGAAGCTGATCTTAGG 0: 1
1: 0
2: 1
3: 18
4: 174
1171249436_1171249444 14 Left 1171249436 20:23637346-23637368 CCCGCGCTGCGGCGCAGCTCGAG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171249436 Original CRISPR CTCGAGCTGCGCCGCAGCGC GGG (reversed) Intronic
900098362 1:949693-949715 CTGGAGCTGGGCAGCAGAGCTGG + Intronic
900737222 1:4306640-4306662 CTCGAGGTGCACCGGAGAGCAGG + Intergenic
905823676 1:41013869-41013891 CTCGAGCAGCCCCGCCACGCTGG + Intergenic
906074092 1:43039260-43039282 CCCGAGCTGAGCCCCAGAGCAGG - Intergenic
913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG + Intergenic
923744360 1:236686638-236686660 CTCGCGCCCCGCCGCAGCCCCGG + Exonic
1062982538 10:1737226-1737248 CTCAAGCTTCGCAGCAGCGGCGG - Exonic
1064380463 10:14837774-14837796 CAGCTGCTGCGCCGCAGCGCGGG + Intronic
1065214802 10:23439251-23439273 TTCCTGCTGCGCCACAGCGCAGG - Intergenic
1079076800 11:17389368-17389390 CCCGACCTGCACCGGAGCGCAGG + Intergenic
1080387829 11:31820022-31820044 TTCGGGCTGCGCGGGAGCGCCGG + Intronic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1116928651 14:50668202-50668224 CCCGAGCAGCGTCGCAGAGCGGG - Exonic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1117913022 14:60652451-60652473 CCCGAGCCGCGCTGCAGCGAGGG - Intronic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1119320699 14:73728511-73728533 CCAGAGCTGAGCCGCAGCGATGG - Intronic
1119759580 14:77141272-77141294 AGCCAGATGCGCCGCAGCGCTGG + Intronic
1120765178 14:88322327-88322349 CTGGAGCTGCGCCGCATGCCCGG - Intronic
1131019971 15:89089132-89089154 CTAGAGCTGTCCAGCAGCGCAGG + Intronic
1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG + Intronic
1133311305 16:4848127-4848149 CGCTAGCTGCGCCGCCGCCCGGG + Intronic
1141691022 16:85596171-85596193 TTCGAGCTGCGATGCAGCGGTGG - Intergenic
1141983587 16:87565319-87565341 CTGGAGATGCCCCGCAGGGCTGG - Intergenic
1142350207 16:89576186-89576208 CCCGAGCTGAGCCCCAGCTCCGG - Intronic
1142586853 17:979436-979458 CTCGGGCTCCGCCGCCGCCCCGG + Exonic
1146208023 17:30921828-30921850 CCCGAGCTCCGCCGACGCGCGGG - Exonic
1147723784 17:42554280-42554302 CGCGAGCAGCACCGCTGCGCTGG - Intronic
1149914928 17:60600227-60600249 CGAGAGCTGGGCCGGAGCGCCGG - Exonic
1152321274 17:79609972-79609994 CTCGAGCAGCGCGGCCGGGCTGG - Intergenic
1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG + Exonic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1165089281 19:33374128-33374150 GACGGGCGGCGCCGCAGCGCTGG - Intronic
1165295838 19:34925407-34925429 ATCGGGCTGCTCCGCAGCACCGG + Intergenic
1168685595 19:58347465-58347487 CTCGAGGTTCGCCGCGGCCCCGG + Exonic
936038305 2:109129581-109129603 CTCGCTCTGCGCAGCAGCGGCGG - Exonic
938407361 2:131039941-131039963 CGCGCCCTGCGCCGCAGCGGCGG - Intronic
948423863 2:237876104-237876126 CTGGAGCTGCCCCGATGCGCCGG - Intronic
948922718 2:241073269-241073291 CTCGAGCTGCGCCGAGGCTGTGG - Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1181510778 22:23387912-23387934 CTGGAGCCGGGCTGCAGCGCAGG - Intergenic
950496494 3:13337216-13337238 CTCGTGCTGCCCCACAGTGCTGG + Intronic
954200776 3:49021953-49021975 CTGGAGCTGCGCCGGAGGTCGGG + Exonic
956678109 3:71753956-71753978 CCCGAGCTCCGCCGCTCCGCCGG - Intronic
961515041 3:127427068-127427090 CTGGCTCTGCGCCTCAGCGCTGG - Intergenic
981366707 4:143912300-143912322 CCCGAGCAGCGTCGCAGAGCGGG - Intergenic
987108697 5:14664867-14664889 CGCGAGCTGCGCCGAGACGCCGG + Exonic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
994353898 5:98774119-98774141 GTTGAGCAGCGCCGCAGCCCCGG + Exonic
1006351131 6:33521826-33521848 CTCGAGCTGGCGCGCAGCCCTGG + Intergenic
1006932543 6:37696833-37696855 CTCGGGCTGCGCCGCCTCGCGGG - Exonic
1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG + Exonic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017021601 6:150143845-150143867 CTCCAGCTGCGCCTCAGCAGCGG + Intronic
1018551301 6:165001699-165001721 CTCGGGCTGCGCAGTAGCCCAGG + Intergenic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1019524256 7:1473715-1473737 CTCGAGCTGCTCTGCCCCGCAGG + Intronic
1023118456 7:36885491-36885513 CTCTAGCTGGGCAGCAGCGGAGG + Intronic
1026817150 7:73521970-73521992 CTAGTGCTGCGCCGCGGGGCCGG - Exonic
1030659685 7:112206213-112206235 CCCGAGCAGCGCTGCAGTGCCGG + Exonic
1031051888 7:116953464-116953486 CGCGAGCTGCGCCTCCGGGCCGG + Exonic
1033288612 7:140062756-140062778 CGCAAGCGGCGCCGCAGCTCGGG + Exonic
1035117469 7:156536692-156536714 CTCGAGCTGTGCGGCAGCTGTGG - Intergenic
1038828469 8:31032905-31032927 CTCCCCCGGCGCCGCAGCGCGGG + Exonic
1047124830 8:121948490-121948512 CTCCACCTGCGCCCCAGTGCGGG + Intergenic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061211970 9:129198885-129198907 CTCGGGCTGCGCGGCAAGGCTGG + Intergenic
1062037849 9:134390654-134390676 GTTGAGCTCCGCCGCAGCCCTGG + Intronic
1189322759 X:40096578-40096600 CCCGAGTTGCGCGGCAGCGGCGG + Intronic