ID: 1171249442

View in Genome Browser
Species Human (GRCh38)
Location 20:23637377-23637399
Sequence TGGAAGCTGATCTTAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171249433_1171249442 14 Left 1171249433 20:23637340-23637362 CCTGCCCCCGCGCTGCGGCGCAG 0: 1
1: 0
2: 2
3: 21
4: 275
Right 1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 65
1171249436_1171249442 8 Left 1171249436 20:23637346-23637368 CCCGCGCTGCGGCGCAGCTCGAG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 65
1171249431_1171249442 20 Left 1171249431 20:23637334-23637356 CCTGTGCCTGCCCCCGCGCTGCG 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 65
1171249434_1171249442 10 Left 1171249434 20:23637344-23637366 CCCCCGCGCTGCGGCGCAGCTCG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 65
1171249435_1171249442 9 Left 1171249435 20:23637345-23637367 CCCCGCGCTGCGGCGCAGCTCGA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 65
1171249437_1171249442 7 Left 1171249437 20:23637347-23637369 CCGCGCTGCGGCGCAGCTCGAGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171249442 Original CRISPR TGGAAGCTGATCTTAGGCGC CGG Intronic
903759095 1:25685353-25685375 TGGCAGCAGAGCTGAGGCGCAGG - Intronic
904904661 1:33886159-33886181 TGGATGCTGAGCTAAGGCTCTGG + Intronic
905183680 1:36181229-36181251 TGGAGGTGGATCTTAGCCGCAGG + Intergenic
919692240 1:200538356-200538378 TGCAAGCTGGTCCTAGGAGCAGG - Intergenic
921083404 1:211763460-211763482 TGGAGGCTGATCTTGGGATCAGG - Intronic
1063104686 10:2982770-2982792 TGGAGGCTGGTCTGAGGCACTGG + Intergenic
1064962656 10:20983001-20983023 TGGAAGCTGATCTTATAGGATGG + Intronic
1067534842 10:47101456-47101478 TGGAGGCTGAACTCAGGCCCAGG + Intergenic
1067877304 10:50018118-50018140 TGGATCCTGATCTGAGGGGCTGG - Intergenic
1069617639 10:69816330-69816352 GGGAAGCTGATGGTAGGGGCAGG + Intronic
1071939529 10:90573491-90573513 TGGAAGCAGATCTTGAGGGCTGG + Intergenic
1074103717 10:110373853-110373875 TGGAAGGTGATCCTGGGAGCAGG - Intergenic
1075978462 10:126717347-126717369 TGAAAGGTGATCTTGGGAGCAGG - Intergenic
1079491737 11:20996473-20996495 TGGAAGCTGAAATTAGGTCCTGG - Intronic
1079785493 11:24666170-24666192 TAGAAGCTGAACTCAGGAGCTGG + Intronic
1080702621 11:34657221-34657243 TGCAAGCAGTTCTTAGGCACTGG - Intronic
1085134176 11:74070187-74070209 TTGAAGCTGATCTTAACCGAAGG + Intronic
1086263311 11:84967418-84967440 TGCAAGCTGTTCTTTGGGGCAGG + Intronic
1088812603 11:113401668-113401690 TGGAAGCTGAACTAGGGCCCTGG - Intergenic
1089404445 11:118185922-118185944 AGGAAGCTGAGCTTAGGCCAAGG - Intergenic
1093954525 12:25201126-25201148 TGAAAGCTGATGTTGGGCGTTGG + Intronic
1100198550 12:92274365-92274387 TGTACGCTGATCTTAGGCCTGGG - Intergenic
1106779819 13:33047622-33047644 TGAAAGCAGATTTTAGGGGCTGG - Intronic
1121161184 14:91742791-91742813 AAGAAGCTTATCTGAGGCGCTGG + Intronic
1123043973 14:105502569-105502591 TGGAGGCTGAGCCCAGGCGCAGG - Intergenic
1129261415 15:74370001-74370023 TGGAAGCTGATCCTACACCCTGG - Intergenic
1133050116 16:3112723-3112745 TGCAAGCTGATCATCTGCGCCGG - Exonic
1137953942 16:52810010-52810032 TGGAACCTGATCTTTGGGGCAGG + Intergenic
1141559130 16:84854998-84855020 TGGAAGCTGAGCCTAGACCCTGG - Intronic
1142636095 17:1258808-1258830 AGGAAGCTGCTCTTTTGCGCTGG - Intergenic
1152661879 17:81546166-81546188 TGGGAGCCGATGTTAGGAGCAGG + Intronic
1158201714 18:54948842-54948864 GGGAAGCTGATCTGAGGAGGTGG + Intronic
1161029347 19:2050707-2050729 CGGGAGCCGATCTTAGGGGCGGG + Intronic
1162907907 19:13834251-13834273 TGGAAGCTGATCTGAAGTGGTGG - Intergenic
1163437995 19:17306673-17306695 TTGAAGCTGATCTCAGGCATCGG + Exonic
1167358110 19:49016352-49016374 TGGGAGCTCAGCTGAGGCGCTGG - Intronic
931706646 2:64951795-64951817 AGGAACCTGATCCTAGGCACAGG - Intergenic
934140128 2:89038868-89038890 TGAAAGCTGATATTAGAAGCAGG - Intergenic
934147157 2:89106549-89106571 TGGAAGCTGATTTGATGTGCAGG + Intergenic
934222112 2:90094045-90094067 TGGAAGCTGATTTGATGTGCAGG - Intergenic
934229109 2:90161682-90161704 TGAAAGCTGATATTAGAAGCAGG + Intergenic
948000717 2:234564747-234564769 TGGATTCTGATCTTGGGAGCTGG - Intergenic
948535190 2:238640683-238640705 TGGAAGGTGATCCGAGGGGCAGG - Intergenic
1171249442 20:23637377-23637399 TGGAAGCTGATCTTAGGCGCCGG + Intronic
1184092085 22:42298196-42298218 TGGAAGCTGAGCCTTGGCTCTGG - Intronic
952959395 3:38580134-38580156 TGGAACTTGATCTAAGGCTCTGG - Intronic
952974795 3:38684595-38684617 TAAAAGCTGAGCTTAGGTGCAGG - Intergenic
953466935 3:43130207-43130229 TGGAAGCTGATCTATGGTGAAGG - Intergenic
962309057 3:134313033-134313055 TGGGAGCCGACCCTAGGCGCCGG + Intergenic
963769841 3:149378711-149378733 TGGAAGCTGGTCTCAGGATCTGG - Intergenic
967509114 3:190289180-190289202 TGGCAGCTGATTTTGGGCTCAGG + Intergenic
976317772 4:83677567-83677589 ATGAAGCTGATCTTAGGGTCAGG + Intergenic
979797375 4:124863153-124863175 TGCAAGCTGATCTTAAGTGTGGG - Intergenic
985487374 5:159019-159041 TGGAAGCTAAGCACAGGCGCAGG - Intronic
995881502 5:116849108-116849130 TAGAATGTGATCTTAGGCGTGGG + Intergenic
997710312 5:135998666-135998688 TGCAAGCTGTTCTTCGGCTCAGG + Intergenic
997710559 5:136000692-136000714 TGCAAGCTGTTCTTTGGCTCAGG + Intergenic
1010490884 6:76475432-76475454 TATAAGCTGATCTTAGGTGGTGG + Intergenic
1026568254 7:71507862-71507884 TGCATGCTGATCTGAGGCGTGGG - Intronic
1029362082 7:100095244-100095266 TAAAAGCTGATCTGAGGCTCTGG + Intronic
1033818239 7:145101573-145101595 TGCAAGCTGATCTGGGGCCCAGG - Intergenic
1034338649 7:150338914-150338936 TGGAAGCTGAGCCTATGGGCTGG - Intronic
1034671441 7:152861935-152861957 AGGAAGCTGATGTGAGGGGCTGG + Intergenic
1040655570 8:49503633-49503655 TGGAGGTTGATTTTAGGCCCGGG - Intergenic
1189712586 X:43828693-43828715 TGGCAGCTCAGCTTAGGTGCAGG - Intronic
1198405152 X:136304951-136304973 TGGAACCTGGTGCTAGGCGCTGG + Exonic
1199977008 X:152900098-152900120 GGGAGGCTGAGCTGAGGCGCTGG - Intergenic