ID: 1171249443

View in Genome Browser
Species Human (GRCh38)
Location 20:23637378-23637400
Sequence GGAAGCTGATCTTAGGCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171249436_1171249443 9 Left 1171249436 20:23637346-23637368 CCCGCGCTGCGGCGCAGCTCGAG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1171249434_1171249443 11 Left 1171249434 20:23637344-23637366 CCCCCGCGCTGCGGCGCAGCTCG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1171249433_1171249443 15 Left 1171249433 20:23637340-23637362 CCTGCCCCCGCGCTGCGGCGCAG 0: 1
1: 0
2: 2
3: 21
4: 275
Right 1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1171249437_1171249443 8 Left 1171249437 20:23637347-23637369 CCGCGCTGCGGCGCAGCTCGAGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1171249431_1171249443 21 Left 1171249431 20:23637334-23637356 CCTGTGCCTGCCCCCGCGCTGCG 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 72
1171249435_1171249443 10 Left 1171249435 20:23637345-23637367 CCCCGCGCTGCGGCGCAGCTCGA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171249443 Original CRISPR GGAAGCTGATCTTAGGCGCC GGG Intronic
907849784 1:58245200-58245222 AGAAGCTGCTCTGAGGCGGCGGG - Intronic
912801152 1:112720427-112720449 TGAAGCTGTTCTCAGGTGCCAGG - Exonic
1063557091 10:7091170-7091192 GGCAGATAATCATAGGCGCCAGG - Intergenic
1063791161 10:9449706-9449728 GGAAGCTGATCTTTGGTGGTTGG - Intergenic
1076072038 10:127497884-127497906 GGGAGCTGCTGTTAGGCCCCTGG + Intergenic
1083053317 11:59796068-59796090 GGAGGCGGAGCTTGGGCGCCTGG - Intronic
1091818446 12:3456649-3456671 GGAAGCTGACCTTAAGCGGGAGG + Intronic
1096178780 12:49539437-49539459 GGAAGGTGTTCTGCGGCGCCAGG - Exonic
1096916361 12:55037659-55037681 TGCAGCTGTTCTTAGGAGCCTGG + Intergenic
1106389108 13:29318038-29318060 GGGAGCTGATCTGTGGGGCCAGG + Intronic
1109893711 13:68654652-68654674 GGGGGCTGATCTTGGGGGCCAGG - Intergenic
1117845508 14:59907343-59907365 GGAAGTTGAACTTAGGAGTCTGG - Intergenic
1121677130 14:95762647-95762669 GGATGCTGATCTTGGCCACCTGG - Intergenic
1122408210 14:101512707-101512729 GAAACCTGGTCTTAGGCGTCTGG + Intergenic
1122702322 14:103598249-103598271 GGAGGGTGATCTGAGGCCCCAGG - Intronic
1122847188 14:104506405-104506427 GGAGGCTGAACTTGGGGGCCAGG - Intronic
1124843331 15:33265026-33265048 GGAAGCTGGTCTCAAGCTCCTGG + Intergenic
1130868158 15:87949678-87949700 GGAGGCTGATGTTGGGAGCCTGG - Intronic
1132517017 16:370527-370549 GGAAGCCGATCTGCCGCGCCTGG + Exonic
1136222142 16:28835659-28835681 GGAAGCTGCTCTGAGGGGACTGG - Exonic
1141777945 16:86136734-86136756 TGAAGCTGAACTTAGACACCTGG + Intergenic
1141941118 16:87276820-87276842 GGGAGGTGGTCTTAGGCCCCAGG - Intronic
1142110486 16:88328538-88328560 GGAAGCTGATCCGATGCACCTGG + Intergenic
1142245641 16:88968963-88968985 GAGAGCAGATCTTAGGCTCCTGG - Intronic
1146469128 17:33110492-33110514 GGAAGCTCACCTCAGGCGCCAGG - Intronic
1166897589 19:46033536-46033558 GGAAGCTGAAGTGAGGCACCGGG + Intergenic
926119435 2:10234264-10234286 GCAAGCTGAGCTCAGGAGCCTGG + Intergenic
926162315 2:10497799-10497821 TGAGGCTGATCTTGGGCACCTGG + Intergenic
926605714 2:14896517-14896539 GGAAGCCGATCCTAAGCGCAAGG + Intergenic
929930814 2:46254160-46254182 GGAAGCTGGTATTAGGGTCCAGG - Intergenic
932451724 2:71814862-71814884 AGAAGCTCATCTTTGGAGCCTGG - Intergenic
935747705 2:106203636-106203658 GGAAGCTGATGTTTGGGGCATGG + Intergenic
936554306 2:113480028-113480050 CGAAGCTGATCTTAAACTCCTGG + Intronic
943288907 2:186042911-186042933 GGAAGATGATTTTAGGAGACAGG - Intergenic
945386596 2:209209257-209209279 GGAAGCTTCTCTTGGGCTCCAGG - Intergenic
947852187 2:233297284-233297306 AGAAGGTGCTCTTAGGCTCCAGG + Intergenic
1171249443 20:23637378-23637400 GGAAGCTGATCTTAGGCGCCGGG + Intronic
1172625551 20:36344671-36344693 GGAACCTGGTCTTGGGAGCCTGG + Intronic
1172768401 20:37363197-37363219 GGAAGCTTTTCTCAGGCCCCTGG - Intronic
1179778861 21:43686728-43686750 GGGTGCTGCTCTTAGGCCCCTGG + Intronic
953179216 3:40580947-40580969 GGAAGCTGGAATTAGGAGCCTGG + Intergenic
956619129 3:71202939-71202961 GGAAGCTTGTCTCAGGCACCCGG + Intronic
959565709 3:107831024-107831046 AGAAGCAGATCTTGGGTGCCAGG + Intergenic
962309058 3:134313034-134313056 GGGAGCCGACCCTAGGCGCCGGG + Intergenic
967994643 3:195157503-195157525 GGAAGCAGCTCTTAGGTGCCAGG - Intronic
968973322 4:3807990-3808012 GGAAGCTGAGCTCAGGCACGAGG + Intergenic
972690141 4:41389196-41389218 GGGGGCTGATCTTAGAGGCCAGG - Intronic
974285017 4:59854335-59854357 GGAACCTGATGTTAGGCACTAGG + Intergenic
976317773 4:83677568-83677590 TGAAGCTGATCTTAGGGTCAGGG + Intergenic
982287534 4:153750613-153750635 GGAAGCTGAGCTCAGGAGACAGG + Intronic
985220986 4:187705336-187705358 GGAAGCTGCTCACAGGGGCCAGG - Intergenic
985607249 5:864630-864652 GGAAGCAGACCTTGGGCTCCAGG - Intronic
1006792596 6:36713824-36713846 GGAAGCTGAACTTGGCCACCTGG - Exonic
1010763648 6:79753426-79753448 GGTAACTGACCTTAGACGCCAGG - Intergenic
1017890117 6:158631004-158631026 GGGAGCTGAACATAGGCCCCAGG - Intronic
1019217526 6:170453426-170453448 GGAAGCTGCTCCCAGGTGCCAGG - Intergenic
1019595238 7:1855364-1855386 GGAAGCGGAACTTAAGCACCTGG - Intronic
1029990325 7:104957419-104957441 GTTAGCTGAACTTAGGCTCCAGG + Intergenic
1035064569 7:156095479-156095501 GGATGCTGATCTTCTGCCCCTGG - Intergenic
1038193854 8:25348424-25348446 GGAAGCTGCTCTTATGCTCCAGG + Intronic
1039473182 8:37826402-37826424 GGACACTGATCCTAGGCCCCTGG - Intronic
1049273715 8:141709321-141709343 GGACGCTGCTCTGAGGGGCCTGG - Intergenic
1049898701 9:137150-137172 CGAAGCTGATCTTAAACTCCTGG - Intronic
1052921009 9:33969335-33969357 GGAAGCTGGTCTTAAACTCCTGG - Intronic
1053151965 9:35749183-35749205 GGAAGGTGACCCTGGGCGCCGGG + Exonic
1053741751 9:41147462-41147484 CGAAGCTGATCTTAAACTCCTGG - Intronic
1054347015 9:63977272-63977294 CGAAGCTGATCTTAAACTCCTGG - Intergenic
1054444745 9:65303609-65303631 CGAAGCTGATCTTAAACTCCTGG - Intergenic
1054485525 9:65717894-65717916 TGAAGCTGATCTTAAACTCCTGG + Intronic
1054686590 9:68283838-68283860 CGAAGCTGATCTTAAACTCCTGG + Intronic
1060290249 9:122295739-122295761 AGAAACTGATCTAAGGGGCCAGG - Intronic
1061151678 9:128832184-128832206 GGAAGGTGGTGTTAGGGGCCTGG - Intergenic
1187261235 X:17686906-17686928 GGAAGCAGATGTTAGGAACCAGG - Intronic
1190020315 X:46868421-46868443 GGAGGCTGATCTCAGGAGCAAGG + Intronic
1196648616 X:118146143-118146165 GGGTGCTGATCTTGGGAGCCAGG - Intergenic
1199976337 X:152897087-152897109 GGAGGCTGGTCTTCGGGGCCAGG + Intergenic