ID: 1171249444

View in Genome Browser
Species Human (GRCh38)
Location 20:23637383-23637405
Sequence CTGATCTTAGGCGCCGGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171249431_1171249444 26 Left 1171249431 20:23637334-23637356 CCTGTGCCTGCCCCCGCGCTGCG 0: 1
1: 0
2: 1
3: 27
4: 262
Right 1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 58
1171249437_1171249444 13 Left 1171249437 20:23637347-23637369 CCGCGCTGCGGCGCAGCTCGAGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 58
1171249436_1171249444 14 Left 1171249436 20:23637346-23637368 CCCGCGCTGCGGCGCAGCTCGAG 0: 1
1: 0
2: 1
3: 2
4: 67
Right 1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 58
1171249433_1171249444 20 Left 1171249433 20:23637340-23637362 CCTGCCCCCGCGCTGCGGCGCAG 0: 1
1: 0
2: 2
3: 21
4: 275
Right 1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 58
1171249434_1171249444 16 Left 1171249434 20:23637344-23637366 CCCCCGCGCTGCGGCGCAGCTCG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 58
1171249435_1171249444 15 Left 1171249435 20:23637345-23637367 CCCCGCGCTGCGGCGCAGCTCGA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG 0: 1
1: 0
2: 1
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171249444 Original CRISPR CTGATCTTAGGCGCCGGGCG CGG Intronic
900118806 1:1040009-1040031 CCCATCTTAGGCGCAGGGAGCGG + Intronic
904314548 1:29651757-29651779 CTGATCTCAGGAGCCCGGAGAGG - Intergenic
909011341 1:70338688-70338710 TTGTTCTTAAGGGCCGGGCGTGG - Intronic
917422407 1:174878513-174878535 TTGATTTTGGGGGCCGGGCGTGG - Intronic
923974785 1:239249865-239249887 CTGTTCTTATGGGCCGGGCGCGG - Intergenic
1064969198 10:21046890-21046912 TTGAGGTTAGGGGCCGGGCGCGG - Intronic
1073520259 10:104121906-104121928 CTGCTCTCGGGCGCTGGGCGGGG + Intergenic
1094491852 12:30965708-30965730 CTGCTCTTTGGGGCAGGGCGAGG - Intronic
1098826154 12:75300264-75300286 TTGCTCTTAGCGGCCGGGCGCGG + Intronic
1121557267 14:94847824-94847846 GTGATCTTAGGGGCCAGGTGCGG - Intergenic
1125553291 15:40564108-40564130 CAGAATTTAGGGGCCGGGCGCGG - Intronic
1125875534 15:43140847-43140869 CTGATATCAGAAGCCGGGCGCGG - Intronic
1125989649 15:44093860-44093882 AAGATATTAGGGGCCGGGCGTGG - Intronic
1126163512 15:45634917-45634939 CTGGGCTGCGGCGCCGGGCGGGG + Exonic
1133084287 16:3349744-3349766 CTGATTTTGGGGGCCAGGCGTGG + Intergenic
1137735665 16:50721093-50721115 CTGAGCTTGGGGGCCGGGTGCGG - Intronic
1140452085 16:75079189-75079211 CTGCTTTTGGGGGCCGGGCGCGG + Intronic
1142631982 17:1231032-1231054 TTGATCTAAGAGGCCGGGCGCGG + Intergenic
1151801151 17:76380657-76380679 TTGAGCTTAGGGGCCGGGCACGG - Intronic
1152626064 17:81388473-81388495 CTCATCTCAGGGGCAGGGCGTGG + Intergenic
1160607541 18:80063515-80063537 CTTACCTTAGGGGCCGGGCATGG - Intronic
1161108705 19:2456639-2456661 CGGGGCTTAGGGGCCGGGCGGGG - Intronic
1161407632 19:4099295-4099317 CAGCTCTTTGGCGTCGGGCGGGG + Exonic
1167409423 19:49336263-49336285 ATGACCCTAGGGGCCGGGCGCGG + Intronic
1167898124 19:52598232-52598254 ATTAACTTAGGGGCCGGGCGCGG - Intronic
1168334715 19:55591337-55591359 CTGATCCTTGGCTCCAGGCGGGG - Intergenic
925414025 2:3656959-3656981 CTGATCCGAGGCGGCGAGCGGGG + Intergenic
937414264 2:121701930-121701952 CTGATCTTAGGAGCAGGGTAGGG - Intergenic
940203305 2:151175174-151175196 TTGATCTTAGGCACAGGCCGTGG - Intergenic
943918724 2:193674562-193674584 ATTATCTCAGGGGCCGGGCGCGG - Intergenic
944060394 2:195565775-195565797 CATATCTTGGGGGCCGGGCGCGG + Intergenic
1171249444 20:23637383-23637405 CTGATCTTAGGCGCCGGGCGCGG + Intronic
1173662388 20:44743758-44743780 CTGATCTTAGGGGAAGGGCAGGG - Intergenic
1173798426 20:45878916-45878938 CTGATCTCAGGGGCTGGGGGAGG - Exonic
1177730645 21:25024097-25024119 CTAATATTTGGGGCCGGGCGTGG - Intergenic
1183702381 22:39457672-39457694 GTGACCTTAGGGGGCGGGCGCGG + Intronic
1184213032 22:43048025-43048047 TTGTTATTAGGGGCCGGGCGCGG + Intronic
950009654 3:9713779-9713801 CAGATGGTAGGGGCCGGGCGCGG + Intronic
957486177 3:80866102-80866124 CAGATGTTTGGGGCCGGGCGCGG + Intergenic
967274701 3:187762633-187762655 CTTATCTTAGGCACCAGGAGAGG - Intergenic
967780723 3:193436812-193436834 CTGATCCCCGGGGCCGGGCGCGG + Intronic
968575832 4:1365745-1365767 CTGCTCTTAGGCAACGGGCCAGG - Intronic
969578698 4:8051256-8051278 ATTATTTTAGGGGCCGGGCGTGG + Intronic
970040086 4:11786752-11786774 ATAATTTTAGGGGCCGGGCGCGG + Intergenic
985818393 5:2143774-2143796 CAGATCTGAGGGGCCGGGCAAGG - Intergenic
1005561642 6:27046854-27046876 CAAATCTTAGGCGCCGGGCGCGG + Intergenic
1008512752 6:52292102-52292124 CAAAACTTTGGCGCCGGGCGCGG + Intergenic
1011765139 6:90611472-90611494 CAGGGCTTAGGCGCCGGGCGGGG + Intergenic
1015176569 6:130315998-130316020 GGGATATTAGGGGCCGGGCGTGG + Intronic
1021474371 7:21043961-21043983 ATGATCAGAGGGGCCGGGCGCGG + Intergenic
1026605628 7:71813637-71813659 AAGATCTTTGGGGCCGGGCGCGG + Intronic
1027557809 7:79687467-79687489 GTCATCATAGGGGCCGGGCGTGG - Intergenic
1031462177 7:122064825-122064847 CCAATATTAGGGGCCGGGCGCGG - Intergenic
1032336771 7:131032432-131032454 ATGATGTTAGGGGCCGGGCGTGG + Intergenic
1032888531 7:136167953-136167975 CTGATCTGACCGGCCGGGCGCGG - Intergenic
1033836178 7:145314929-145314951 TTAATCTTTGGGGCCGGGCGCGG - Intergenic
1050856054 9:10356969-10356991 CTGTTCTTATGGGCCGGGCGTGG - Intronic
1051399113 9:16660162-16660184 CACATCTTTGGGGCCGGGCGCGG + Intronic
1187018476 X:15354259-15354281 ATAATCTTAGGGGCCGGGCACGG - Intronic
1187968578 X:24637349-24637371 TTGATCTTTGGGGCCGGGCACGG + Intronic
1200012184 X:153127440-153127462 CCTACCTTAGGCGCCAGGCGCGG - Intergenic
1200027416 X:153272479-153272501 CCTACCTTAGGCGCCAGGCGCGG + Intergenic
1200155194 X:153971384-153971406 CTGCACTAAGGCGCTGGGCGGGG - Exonic
1200301935 X:154985143-154985165 ATCATCCTAGGGGCCGGGCGCGG + Intronic