ID: 1171250165

View in Genome Browser
Species Human (GRCh38)
Location 20:23640476-23640498
Sequence CCATAAGGGCATTTGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171250165_1171250176 27 Left 1171250165 20:23640476-23640498 CCCTGTGGCAAATGCCCTTATGG No data
Right 1171250176 20:23640526-23640548 AGAAAACTCTGGGCCTTTGCAGG No data
1171250165_1171250173 16 Left 1171250165 20:23640476-23640498 CCCTGTGGCAAATGCCCTTATGG No data
Right 1171250173 20:23640515-23640537 CCAGAAACACCAGAAAACTCTGG No data
1171250165_1171250177 28 Left 1171250165 20:23640476-23640498 CCCTGTGGCAAATGCCCTTATGG No data
Right 1171250177 20:23640527-23640549 GAAAACTCTGGGCCTTTGCAGGG No data
1171250165_1171250174 17 Left 1171250165 20:23640476-23640498 CCCTGTGGCAAATGCCCTTATGG No data
Right 1171250174 20:23640516-23640538 CAGAAACACCAGAAAACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171250165 Original CRISPR CCATAAGGGCATTTGCCACA GGG (reversed) Intergenic
No off target data available for this crispr