ID: 1171252000

View in Genome Browser
Species Human (GRCh38)
Location 20:23655880-23655902
Sequence ATGCAGCCCAGGAAGCGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252000_1171252010 25 Left 1171252000 20:23655880-23655902 CCCCCTCGCTTCCTGGGCTGCAT No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252000 Original CRISPR ATGCAGCCCAGGAAGCGAGG GGG (reversed) Intergenic
No off target data available for this crispr