ID: 1171252002

View in Genome Browser
Species Human (GRCh38)
Location 20:23655882-23655904
Sequence CAATGCAGCCCAGGAAGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252002_1171252013 30 Left 1171252002 20:23655882-23655904 CCCTCGCTTCCTGGGCTGCATTG No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252002_1171252012 29 Left 1171252002 20:23655882-23655904 CCCTCGCTTCCTGGGCTGCATTG No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252002_1171252010 23 Left 1171252002 20:23655882-23655904 CCCTCGCTTCCTGGGCTGCATTG No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252002 Original CRISPR CAATGCAGCCCAGGAAGCGA GGG (reversed) Intergenic