ID: 1171252006

View in Genome Browser
Species Human (GRCh38)
Location 20:23655891-23655913
Sequence CGGCCCTCTCAATGCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252006_1171252012 20 Left 1171252006 20:23655891-23655913 CCTGGGCTGCATTGAGAGGGCCG No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252006_1171252013 21 Left 1171252006 20:23655891-23655913 CCTGGGCTGCATTGAGAGGGCCG No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252006_1171252010 14 Left 1171252006 20:23655891-23655913 CCTGGGCTGCATTGAGAGGGCCG No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252006 Original CRISPR CGGCCCTCTCAATGCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr