ID: 1171252008

View in Genome Browser
Species Human (GRCh38)
Location 20:23655911-23655933
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252008_1171252014 23 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252014 20:23655957-23655979 GCCAGACCTCTCCCACCCCTCGG No data
1171252008_1171252013 1 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252008_1171252017 27 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252017 20:23655961-23655983 GACCTCTCCCACCCCTCGGGAGG No data
1171252008_1171252012 0 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252008_1171252016 24 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252016 20:23655958-23655980 CCAGACCTCTCCCACCCCTCGGG No data
1171252008_1171252010 -6 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252008 Original CRISPR AAGTGAAAAGAAGGCAACAC CGG (reversed) Intergenic