ID: 1171252009

View in Genome Browser
Species Human (GRCh38)
Location 20:23655920-23655942
Sequence TCAGTGAGGAAGTGAAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252009_1171252012 -9 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252009_1171252013 -8 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252009_1171252016 15 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252016 20:23655958-23655980 CCAGACCTCTCCCACCCCTCGGG No data
1171252009_1171252014 14 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252014 20:23655957-23655979 GCCAGACCTCTCCCACCCCTCGG No data
1171252009_1171252017 18 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252017 20:23655961-23655983 GACCTCTCCCACCCCTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252009 Original CRISPR TCAGTGAGGAAGTGAAAAGA AGG (reversed) Intergenic
No off target data available for this crispr