ID: 1171252010

View in Genome Browser
Species Human (GRCh38)
Location 20:23655928-23655950
Sequence TCACTTCCTCACTGAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252006_1171252010 14 Left 1171252006 20:23655891-23655913 CCTGGGCTGCATTGAGAGGGCCG No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data
1171252000_1171252010 25 Left 1171252000 20:23655880-23655902 CCCCCTCGCTTCCTGGGCTGCAT No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data
1171252008_1171252010 -6 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data
1171252003_1171252010 22 Left 1171252003 20:23655883-23655905 CCTCGCTTCCTGGGCTGCATTGA No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data
1171252001_1171252010 24 Left 1171252001 20:23655881-23655903 CCCCTCGCTTCCTGGGCTGCATT No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data
1171252002_1171252010 23 Left 1171252002 20:23655882-23655904 CCCTCGCTTCCTGGGCTGCATTG No data
Right 1171252010 20:23655928-23655950 TCACTTCCTCACTGAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252010 Original CRISPR TCACTTCCTCACTGAGAGAC TGG Intergenic
No off target data available for this crispr