ID: 1171252012

View in Genome Browser
Species Human (GRCh38)
Location 20:23655934-23655956
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252002_1171252012 29 Left 1171252002 20:23655882-23655904 CCCTCGCTTCCTGGGCTGCATTG No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252009_1171252012 -9 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252001_1171252012 30 Left 1171252001 20:23655881-23655903 CCCCTCGCTTCCTGGGCTGCATT No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252003_1171252012 28 Left 1171252003 20:23655883-23655905 CCTCGCTTCCTGGGCTGCATTGA No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252006_1171252012 20 Left 1171252006 20:23655891-23655913 CCTGGGCTGCATTGAGAGGGCCG No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
1171252008_1171252012 0 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252012 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252012 Original CRISPR CCTCACTGAGAGACTGGAAA AGG Intergenic