ID: 1171252013

View in Genome Browser
Species Human (GRCh38)
Location 20:23655935-23655957
Sequence CTCACTGAGAGACTGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252006_1171252013 21 Left 1171252006 20:23655891-23655913 CCTGGGCTGCATTGAGAGGGCCG No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252009_1171252013 -8 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252003_1171252013 29 Left 1171252003 20:23655883-23655905 CCTCGCTTCCTGGGCTGCATTGA No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252002_1171252013 30 Left 1171252002 20:23655882-23655904 CCCTCGCTTCCTGGGCTGCATTG No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data
1171252008_1171252013 1 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252013 20:23655935-23655957 CTCACTGAGAGACTGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252013 Original CRISPR CTCACTGAGAGACTGGAAAA GGG Intergenic
No off target data available for this crispr