ID: 1171252014

View in Genome Browser
Species Human (GRCh38)
Location 20:23655957-23655979
Sequence GCCAGACCTCTCCCACCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252008_1171252014 23 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252014 20:23655957-23655979 GCCAGACCTCTCCCACCCCTCGG No data
1171252011_1171252014 0 Left 1171252011 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
Right 1171252014 20:23655957-23655979 GCCAGACCTCTCCCACCCCTCGG No data
1171252009_1171252014 14 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252014 20:23655957-23655979 GCCAGACCTCTCCCACCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252014 Original CRISPR GCCAGACCTCTCCCACCCCT CGG Intergenic