ID: 1171252017

View in Genome Browser
Species Human (GRCh38)
Location 20:23655961-23655983
Sequence GACCTCTCCCACCCCTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252008_1171252017 27 Left 1171252008 20:23655911-23655933 CCGGTGTTGCCTTCTTTTCACTT No data
Right 1171252017 20:23655961-23655983 GACCTCTCCCACCCCTCGGGAGG No data
1171252011_1171252017 4 Left 1171252011 20:23655934-23655956 CCTCACTGAGAGACTGGAAAAGG No data
Right 1171252017 20:23655961-23655983 GACCTCTCCCACCCCTCGGGAGG No data
1171252009_1171252017 18 Left 1171252009 20:23655920-23655942 CCTTCTTTTCACTTCCTCACTGA No data
Right 1171252017 20:23655961-23655983 GACCTCTCCCACCCCTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252017 Original CRISPR GACCTCTCCCACCCCTCGGG AGG Intergenic