ID: 1171252938

View in Genome Browser
Species Human (GRCh38)
Location 20:23663202-23663224
Sequence ACCTCCCTCTGCAGCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171252938_1171252944 -3 Left 1171252938 20:23663202-23663224 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171252944 20:23663222-23663244 GGTGCAGGTAGAGTGAGTGGTGG No data
1171252938_1171252946 -1 Left 1171252938 20:23663202-23663224 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171252946 20:23663224-23663246 TGCAGGTAGAGTGAGTGGTGGGG No data
1171252938_1171252943 -6 Left 1171252938 20:23663202-23663224 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171252943 20:23663219-23663241 GGAGGTGCAGGTAGAGTGAGTGG No data
1171252938_1171252948 21 Left 1171252938 20:23663202-23663224 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171252948 20:23663246-23663268 GAACGTGGCTGTCCCTTGTGAGG No data
1171252938_1171252947 6 Left 1171252938 20:23663202-23663224 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171252947 20:23663231-23663253 AGAGTGAGTGGTGGGGAACGTGG No data
1171252938_1171252945 -2 Left 1171252938 20:23663202-23663224 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171252945 20:23663223-23663245 GTGCAGGTAGAGTGAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171252938 Original CRISPR ACCTCCCTCTGCAGCACAGG GGG (reversed) Intergenic