ID: 1171253789

View in Genome Browser
Species Human (GRCh38)
Location 20:23670674-23670696
Sequence AGGCAAAGATCTATGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171253789_1171253793 8 Left 1171253789 20:23670674-23670696 CCATCCACCATAGATCTTTGCCT No data
Right 1171253793 20:23670705-23670727 ATAACATGCTTCCCAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171253789 Original CRISPR AGGCAAAGATCTATGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr