ID: 1171253793

View in Genome Browser
Species Human (GRCh38)
Location 20:23670705-23670727
Sequence ATAACATGCTTCCCAAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171253791_1171253793 1 Left 1171253791 20:23670681-23670703 CCATAGATCTTTGCCTCTTCAAA No data
Right 1171253793 20:23670705-23670727 ATAACATGCTTCCCAAGTTCAGG No data
1171253787_1171253793 10 Left 1171253787 20:23670672-23670694 CCCCATCCACCATAGATCTTTGC No data
Right 1171253793 20:23670705-23670727 ATAACATGCTTCCCAAGTTCAGG No data
1171253788_1171253793 9 Left 1171253788 20:23670673-23670695 CCCATCCACCATAGATCTTTGCC No data
Right 1171253793 20:23670705-23670727 ATAACATGCTTCCCAAGTTCAGG No data
1171253789_1171253793 8 Left 1171253789 20:23670674-23670696 CCATCCACCATAGATCTTTGCCT No data
Right 1171253793 20:23670705-23670727 ATAACATGCTTCCCAAGTTCAGG No data
1171253790_1171253793 4 Left 1171253790 20:23670678-23670700 CCACCATAGATCTTTGCCTCTTC No data
Right 1171253793 20:23670705-23670727 ATAACATGCTTCCCAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171253793 Original CRISPR ATAACATGCTTCCCAAGTTC AGG Intergenic
No off target data available for this crispr