ID: 1171254577

View in Genome Browser
Species Human (GRCh38)
Location 20:23679755-23679777
Sequence CACCCTCTCCACTCCATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171254577_1171254583 12 Left 1171254577 20:23679755-23679777 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171254583 20:23679790-23679812 GATCTCTGCATGAGAAGGGAGGG No data
1171254577_1171254582 11 Left 1171254577 20:23679755-23679777 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171254582 20:23679789-23679811 AGATCTCTGCATGAGAAGGGAGG No data
1171254577_1171254581 8 Left 1171254577 20:23679755-23679777 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171254581 20:23679786-23679808 CCAAGATCTCTGCATGAGAAGGG No data
1171254577_1171254585 22 Left 1171254577 20:23679755-23679777 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171254585 20:23679800-23679822 TGAGAAGGGAGGGGAAGCTCAGG No data
1171254577_1171254579 7 Left 1171254577 20:23679755-23679777 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171254579 20:23679785-23679807 ACCAAGATCTCTGCATGAGAAGG No data
1171254577_1171254584 13 Left 1171254577 20:23679755-23679777 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171254584 20:23679791-23679813 ATCTCTGCATGAGAAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171254577 Original CRISPR CACCCTCTCCACTCCATGCT GGG (reversed) Intergenic
No off target data available for this crispr