ID: 1171259426

View in Genome Browser
Species Human (GRCh38)
Location 20:23718519-23718541
Sequence ACCTCCCTCTGCAGCACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171259426_1171259432 -3 Left 1171259426 20:23718519-23718541 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171259432 20:23718539-23718561 GGTGCAGGTAGAGTGAGTGGTGG No data
1171259426_1171259435 6 Left 1171259426 20:23718519-23718541 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171259435 20:23718548-23718570 AGAGTGAGTGGTGGGGAACGTGG No data
1171259426_1171259433 -2 Left 1171259426 20:23718519-23718541 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171259433 20:23718540-23718562 GTGCAGGTAGAGTGAGTGGTGGG No data
1171259426_1171259431 -6 Left 1171259426 20:23718519-23718541 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171259431 20:23718536-23718558 GGAGGTGCAGGTAGAGTGAGTGG No data
1171259426_1171259434 -1 Left 1171259426 20:23718519-23718541 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171259434 20:23718541-23718563 TGCAGGTAGAGTGAGTGGTGGGG No data
1171259426_1171259436 21 Left 1171259426 20:23718519-23718541 CCCCCTGTGCTGCAGAGGGAGGT No data
Right 1171259436 20:23718563-23718585 GAACGTGGCTGTCCCTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171259426 Original CRISPR ACCTCCCTCTGCAGCACAGG GGG (reversed) Intergenic