ID: 1171261063

View in Genome Browser
Species Human (GRCh38)
Location 20:23735027-23735049
Sequence CACCCTCTCCACTCCATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171261063_1171261066 12 Left 1171261063 20:23735027-23735049 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171261066 20:23735062-23735084 GATCTCTGCATGAGAAGAGAGGG No data
1171261063_1171261065 11 Left 1171261063 20:23735027-23735049 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171261065 20:23735061-23735083 AGATCTCTGCATGAGAAGAGAGG No data
1171261063_1171261067 13 Left 1171261063 20:23735027-23735049 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171261067 20:23735063-23735085 ATCTCTGCATGAGAAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171261063 Original CRISPR CACCCTCTCCACTCCATGCT GGG (reversed) Intergenic
No off target data available for this crispr