ID: 1171261065

View in Genome Browser
Species Human (GRCh38)
Location 20:23735061-23735083
Sequence AGATCTCTGCATGAGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171261059_1171261065 23 Left 1171261059 20:23735015-23735037 CCTGGGAATGTGCCCAGCATGGA No data
Right 1171261065 20:23735061-23735083 AGATCTCTGCATGAGAAGAGAGG No data
1171261063_1171261065 11 Left 1171261063 20:23735027-23735049 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171261065 20:23735061-23735083 AGATCTCTGCATGAGAAGAGAGG No data
1171261064_1171261065 10 Left 1171261064 20:23735028-23735050 CCAGCATGGAGTGGAGAGGGTGC No data
Right 1171261065 20:23735061-23735083 AGATCTCTGCATGAGAAGAGAGG No data
1171261057_1171261065 30 Left 1171261057 20:23735008-23735030 CCAAATGCCTGGGAATGTGCCCA No data
Right 1171261065 20:23735061-23735083 AGATCTCTGCATGAGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171261065 Original CRISPR AGATCTCTGCATGAGAAGAG AGG Intergenic
No off target data available for this crispr