ID: 1171261066

View in Genome Browser
Species Human (GRCh38)
Location 20:23735062-23735084
Sequence GATCTCTGCATGAGAAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171261064_1171261066 11 Left 1171261064 20:23735028-23735050 CCAGCATGGAGTGGAGAGGGTGC No data
Right 1171261066 20:23735062-23735084 GATCTCTGCATGAGAAGAGAGGG No data
1171261063_1171261066 12 Left 1171261063 20:23735027-23735049 CCCAGCATGGAGTGGAGAGGGTG No data
Right 1171261066 20:23735062-23735084 GATCTCTGCATGAGAAGAGAGGG No data
1171261059_1171261066 24 Left 1171261059 20:23735015-23735037 CCTGGGAATGTGCCCAGCATGGA No data
Right 1171261066 20:23735062-23735084 GATCTCTGCATGAGAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171261066 Original CRISPR GATCTCTGCATGAGAAGAGA GGG Intergenic
No off target data available for this crispr