ID: 1171263962

View in Genome Browser
Species Human (GRCh38)
Location 20:23755289-23755311
Sequence GTCATCTCCTTGACATCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171263955_1171263962 25 Left 1171263955 20:23755241-23755263 CCTGCAGAGGCCTGGCCATGAGG No data
Right 1171263962 20:23755289-23755311 GTCATCTCCTTGACATCTCTGGG No data
1171263958_1171263962 10 Left 1171263958 20:23755256-23755278 CCATGAGGAAAACAGATGACTCT No data
Right 1171263962 20:23755289-23755311 GTCATCTCCTTGACATCTCTGGG No data
1171263957_1171263962 15 Left 1171263957 20:23755251-23755273 CCTGGCCATGAGGAAAACAGATG No data
Right 1171263962 20:23755289-23755311 GTCATCTCCTTGACATCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171263962 Original CRISPR GTCATCTCCTTGACATCTCT GGG Intergenic
No off target data available for this crispr