ID: 1171266138

View in Genome Browser
Species Human (GRCh38)
Location 20:23773511-23773533
Sequence AACCATAGGAAGCAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171266138_1171266142 6 Left 1171266138 20:23773511-23773533 CCCTGCAGCTGCTTCCTATGGTT No data
Right 1171266142 20:23773540-23773562 GCAACAACCCTAAGCACATGAGG No data
1171266138_1171266143 9 Left 1171266138 20:23773511-23773533 CCCTGCAGCTGCTTCCTATGGTT No data
Right 1171266143 20:23773543-23773565 ACAACCCTAAGCACATGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171266138 Original CRISPR AACCATAGGAAGCAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr