ID: 1171269405

View in Genome Browser
Species Human (GRCh38)
Location 20:23801867-23801889
Sequence CTGGCTACACGGATCAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171269405_1171269409 -2 Left 1171269405 20:23801867-23801889 CCTTCTCTGATCCGTGTAGCCAG No data
Right 1171269409 20:23801888-23801910 AGGTGTGAACCTTTTGATTTTGG No data
1171269405_1171269412 29 Left 1171269405 20:23801867-23801889 CCTTCTCTGATCCGTGTAGCCAG No data
Right 1171269412 20:23801919-23801941 AGCACTTTTATGTTCACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171269405 Original CRISPR CTGGCTACACGGATCAGAGA AGG (reversed) Intergenic
No off target data available for this crispr