ID: 1171269405 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:23801867-23801889 |
| Sequence | CTGGCTACACGGATCAGAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171269405_1171269409 | -2 | Left | 1171269405 | 20:23801867-23801889 | CCTTCTCTGATCCGTGTAGCCAG | No data | ||
| Right | 1171269409 | 20:23801888-23801910 | AGGTGTGAACCTTTTGATTTTGG | No data | ||||
| 1171269405_1171269412 | 29 | Left | 1171269405 | 20:23801867-23801889 | CCTTCTCTGATCCGTGTAGCCAG | No data | ||
| Right | 1171269412 | 20:23801919-23801941 | AGCACTTTTATGTTCACTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171269405 | Original CRISPR | CTGGCTACACGGATCAGAGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||