ID: 1171270182

View in Genome Browser
Species Human (GRCh38)
Location 20:23810869-23810891
Sequence CACCCTCTCCACTCCATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171270182_1171270183 7 Left 1171270182 20:23810869-23810891 CCTAGCATGGAGTGGAGAGGGTG No data
Right 1171270183 20:23810899-23810921 AGAAAGATCTCTGCGTGAGAAGG No data
1171270182_1171270185 12 Left 1171270182 20:23810869-23810891 CCTAGCATGGAGTGGAGAGGGTG No data
Right 1171270185 20:23810904-23810926 GATCTCTGCGTGAGAAGGGAAGG No data
1171270182_1171270186 13 Left 1171270182 20:23810869-23810891 CCTAGCATGGAGTGGAGAGGGTG No data
Right 1171270186 20:23810905-23810927 ATCTCTGCGTGAGAAGGGAAGGG No data
1171270182_1171270184 8 Left 1171270182 20:23810869-23810891 CCTAGCATGGAGTGGAGAGGGTG No data
Right 1171270184 20:23810900-23810922 GAAAGATCTCTGCGTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171270182 Original CRISPR CACCCTCTCCACTCCATGCT AGG (reversed) Intergenic
No off target data available for this crispr