ID: 1171272356

View in Genome Browser
Species Human (GRCh38)
Location 20:23826800-23826822
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1529
Summary {0: 2, 1: 1, 2: 12, 3: 171, 4: 1343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171272356 Original CRISPR CAGAAAGAGGAGGAGGAGTC AGG (reversed) Intergenic
900030102 1:365016-365038 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900050754 1:594080-594102 TGGAAAGAGGAGGAGGAGGACGG - Intergenic
900123946 1:1061386-1061408 CCGAAGGAGGAGGAGGAGCTGGG + Intergenic
900149098 1:1170537-1170559 CGGAGAGAGGAGGAGGAGGGAGG - Intergenic
900247132 1:1641760-1641782 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900258356 1:1708892-1708914 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900419724 1:2550686-2550708 CAGGAAGAGGAGGAGGCAGCCGG + Intergenic
900471128 1:2855513-2855535 CAGAGAGTTGAGGAGGATTCTGG - Intergenic
900533723 1:3167184-3167206 AAAATAGAGGAGGAGGAGCCAGG + Intronic
900541011 1:3202742-3202764 CAGAAAGAGGAGGACGGCTCAGG + Intronic
900818442 1:4868339-4868361 AAGAGAGAGGAGGAGGAGAAGGG - Intergenic
900851953 1:5150738-5150760 CAGAGAGAGGATGAGGAGAGTGG - Intergenic
901077412 1:6563988-6564010 CAGGAGGAGAAGGAGGAGTCTGG + Intronic
901120412 1:6887545-6887567 CAGAGAGAGGAGGAGACATCTGG - Intronic
901235944 1:7667665-7667687 CAGAAAGGACAGAAGGAGTCAGG - Intronic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901243909 1:7713296-7713318 GAGAAAGAGGAGGAAGAGTATGG + Intronic
901323769 1:8355323-8355345 CAGGCAGAGGGGGAGGAGCCTGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901475844 1:9488711-9488733 CAGACTGAGAAGGAGCAGTCAGG + Intergenic
901629750 1:10642296-10642318 GAGGAGGAGGAGGAGGAGCCGGG + Intronic
901770804 1:11529503-11529525 CGGAAAGGCTAGGAGGAGTCAGG - Intronic
901864858 1:12098851-12098873 CAGGAAGAGGATGAGGAGGTGGG - Intronic
902161049 1:14530608-14530630 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
902279497 1:15363994-15364016 TTTAAACAGGAGGAGGAGTCAGG - Intronic
902688989 1:18097900-18097922 GAGAAAGAGGAGGAGGTGTCAGG - Intergenic
902732138 1:18376646-18376668 CTCCAGGAGGAGGAGGAGTCTGG - Intronic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
902852656 1:19172675-19172697 CAAATAGTGCAGGAGGAGTCAGG - Intronic
902961569 1:19967053-19967075 GAGAAGGAGGAGGAGGAAACAGG - Intergenic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903337226 1:22633269-22633291 GAGGAGGAGGAGGAGGAGACTGG + Intergenic
903360572 1:22774405-22774427 CAGCCAGAGCAGGAGGAGTCAGG + Intronic
903374580 1:22857892-22857914 TGGAAAGGGGAGGAGGAGCCGGG - Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903428603 1:23273864-23273886 CTGGAAGAGGAGGAGGAGATGGG + Intergenic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903644521 1:24886522-24886544 CAGAAAGAGGAGGGAGTGGCTGG - Intergenic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
904079380 1:27862539-27862561 CAGAGAGAGGAGGAGAGGTGGGG - Intergenic
904261711 1:29291389-29291411 CTGCAGGAGAAGGAGGAGTCTGG + Intronic
904352629 1:29918867-29918889 CTGATGGATGAGGAGGAGTCAGG + Intergenic
904412219 1:30331344-30331366 CAGAAAGGGGTGAGGGAGTCAGG - Intergenic
904521995 1:31102785-31102807 CAGTATGGGGAGGTGGAGTCAGG - Intergenic
904920132 1:34000961-34000983 TAGAAAGAGGAGGAGGAAGGAGG + Intronic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
905508378 1:38498881-38498903 CTCAGGGAGGAGGAGGAGTCTGG - Intergenic
905540109 1:38753919-38753941 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
905575804 1:39043745-39043767 AAGAAGGAGGAGGAGGCGGCAGG + Intergenic
905584530 1:39106030-39106052 GAGGAGGAGGAGGAGGAGTTGGG + Intronic
905867967 1:41386585-41386607 AAGAAAGGGGAGGAGGAGAAAGG - Intergenic
906013345 1:42550475-42550497 CAGCAAGATGAGGAGGAGGTAGG - Intronic
906182188 1:43831463-43831485 CAGAAAGAGTTGGTGGTGTCTGG - Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192390 1:43906258-43906280 GAAGAGGAGGAGGAGGAGTCAGG - Intronic
907305915 1:53513156-53513178 CAGGGAGAGGAGGAGGCCTCAGG - Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
907858495 1:58327318-58327340 GAGAAGGAAGAGGAGGAGGCAGG + Intronic
907962582 1:59297052-59297074 GAGGAAGGGGAGGAGGAGGCAGG - Exonic
909130196 1:71725741-71725763 CAGAAAGAGGAGGAAAAGGATGG - Intronic
909591928 1:77360220-77360242 CTGATAGAGGAAGAAGAGTCGGG + Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
909736285 1:78966638-78966660 CTGGAAGAGGAGGGGGAGTGAGG - Intronic
909885281 1:80934399-80934421 GAGAAAGAGGAGGAAGAGGAGGG + Intergenic
909957841 1:81801332-81801354 GGGAAGGAGGAGGAGGAGGCTGG + Intronic
910033321 1:82759024-82759046 GAGAAACAGGAGGAGGAAGCAGG - Intergenic
910394625 1:86779455-86779477 CTGAAGGATGAGGAGGAGTAAGG + Intergenic
911023761 1:93414920-93414942 AAGAAGGAGGAGGAGGAGAAAGG + Intergenic
911166093 1:94725690-94725712 CTCAAAGAGTAGGAGGAGCCAGG + Intergenic
911466033 1:98253285-98253307 AATAAGGAGGAGGAGGAGTCAGG - Intergenic
912156620 1:106929013-106929035 CAGAAAGAGGAGATGGATTCAGG + Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912549713 1:110477498-110477520 CAGAAAGAGGTGGCTGAGTCTGG + Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912593428 1:110850375-110850397 CAAAAAGCAGAGGAGGATTCAGG - Intergenic
912933121 1:113981749-113981771 AAGAAAGAGGAGGAGGTTTGAGG + Exonic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913384187 1:118241713-118241735 GAGAAAAAGAGGGAGGAGTCAGG - Intergenic
913415227 1:118598022-118598044 CAAAAAGAGAAGGAGGAATAAGG + Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
914357329 1:146898328-146898350 AAGAAAGAAGAGGAGGAGGGAGG + Intergenic
914418645 1:147508267-147508289 CAGAAAGGGGATGAAGAATCTGG - Intergenic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
914917840 1:151829319-151829341 TGGACAGAGGTGGAGGAGTCAGG - Intronic
914932697 1:151949242-151949264 AAAAAAGAGGAGGAGGAGGAAGG - Intergenic
914937565 1:151993922-151993944 CAGGAAGAGGGGGAGGAGACAGG - Exonic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915035308 1:152918729-152918751 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
915086942 1:153395417-153395439 CAGAATGAGGTGGAGGTTTCAGG - Intergenic
915361619 1:155289400-155289422 CAGGAGGAGTAGGAGGAGGCAGG + Exonic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
916023456 1:160814306-160814328 GAGAAAGAGGAAGAGGAGGAGGG + Intronic
916184493 1:162117586-162117608 CTGAAAGACAAGGAGGAGTGAGG - Intronic
916282265 1:163064710-163064732 AAGAAAGAGGAGTAAGAGGCAGG + Intergenic
916400896 1:164447706-164447728 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916881664 1:169024696-169024718 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
917021487 1:170593319-170593341 CTCAAAGAGGAGGAAGAGTTGGG - Intergenic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
917534568 1:175864823-175864845 CAGAAAGGGGAGCAGGAGAGTGG + Intergenic
917729699 1:177862371-177862393 CTGAAAGAAGAGAAGGAGTGAGG - Intergenic
918002937 1:180514592-180514614 GAGGAAGAGGAGGAGGAGGGGGG + Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
919257454 1:195142377-195142399 AAGAAGGAGGAGGAGGAGAAAGG - Intergenic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919507419 1:198416784-198416806 CAGGAAGATGAGGAGGAATAAGG - Intergenic
919737692 1:200963549-200963571 GAGAAAGAGAAGGAGAAGTGGGG - Intergenic
919922642 1:202175642-202175664 CAGAAAGAGCAGGAAGACTCAGG - Intergenic
920217926 1:204374686-204374708 CAGACAGAGGAGGAGGATAAAGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
920537121 1:206745054-206745076 CAGAAAGAGCAGGAGGTATCTGG - Intergenic
920684750 1:208100981-208101003 AAGGAAGAGGGGGAGGAGTTTGG - Intronic
920777921 1:208958451-208958473 CAGAAAGACGAGGAAAAGTTTGG + Intergenic
921058627 1:211563901-211563923 CAGAAAGATGAGGAGAAGAAAGG + Intergenic
921070784 1:211655989-211656011 GGGAAAGAGGAGCAGGAGTGGGG - Intergenic
921231865 1:213081350-213081372 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
921284293 1:213595143-213595165 CACAAAGAAGAGGAAGAGTCTGG - Intergenic
921295046 1:213693533-213693555 CAGAAAAAGGAAGAGGGATCGGG + Intergenic
921365680 1:214371430-214371452 CACAAAGAGGAGGAGGGATGAGG + Intronic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921452508 1:215324939-215324961 CAGAAGGTGAAGGAGGAGTAAGG + Intergenic
921510478 1:216022016-216022038 GAGAGAGAGGAGGAAGTGTCAGG - Intronic
921572505 1:216796164-216796186 CAGAAATAGAAGGAGCAGTGGGG + Intronic
922516175 1:226209809-226209831 CAGAGAGAGGGAGAGGAGCCAGG + Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922671368 1:227510626-227510648 AGGGAAGAGGAGGAGGAGGCAGG + Intergenic
922766289 1:228158215-228158237 GAGGAGGAGGAGGAGGAGACGGG + Exonic
922812964 1:228428271-228428293 AAGAGAGAGGAGGAGGTGCCGGG + Intergenic
922936294 1:229425713-229425735 AAGAAAGAGGAGGAGGGGGGAGG + Intergenic
923072353 1:230577592-230577614 AAGAAGGAGGAGGAGGGGTAGGG - Intergenic
923218197 1:231869611-231869633 AAGAAAGAGGAGGAGGTGCCAGG + Intronic
923237846 1:232051650-232051672 GAGACAGAGGAGGAGGAGGTAGG + Intergenic
923504847 1:234596353-234596375 CAGAAACGGGAGGAACAGTCTGG + Intergenic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
923834168 1:237591223-237591245 CACAAAGAGGAGGAGGAGAAGGG - Intronic
924204585 1:241698677-241698699 CAGAAAGAAGAGGAAGAATGGGG - Intronic
924281402 1:242440811-242440833 CAGTAGGAGGAGGCGGAGTGAGG - Intronic
924608668 1:245556296-245556318 AAGAAGGAGGAGGAGGAGGGAGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
1062833467 10:621566-621588 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1063159455 10:3408759-3408781 AGGAAAGAGGAGGAGGAGGGAGG + Intergenic
1063159508 10:3408955-3408977 AAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063602991 10:7498810-7498832 CCAAAAGAGGAGGAGGAGGGAGG + Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1063884994 10:10568286-10568308 GAGGAAGGGGAGGATGAGTCCGG + Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1063995943 10:11619422-11619444 AAGAAAGAGGAGCAGGCTTCAGG - Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064628645 10:17286661-17286683 AAGAGGGAGGAGGAGGTGTCAGG + Intergenic
1064784396 10:18877911-18877933 AAGAAAGTGGAGCAGGAGTGGGG - Intergenic
1064784639 10:18880532-18880554 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1064850843 10:19707077-19707099 GAGGAAGAGGAGGAGGAGAAGGG - Intronic
1065023000 10:21516534-21516556 GAGGAAGAGGAGGAGGAGGGGGG - Exonic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065140390 10:22714132-22714154 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1065205228 10:23350995-23351017 AAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1065319455 10:24495617-24495639 CAGAAAGATGAAGAGGACTTAGG + Intronic
1065500860 10:26381097-26381119 GTGAAAGAGGAGGAGGAGGGAGG - Intergenic
1065589757 10:27252473-27252495 AAGAGCGAGGAGGAGGAGTACGG - Intergenic
1065643164 10:27805547-27805569 CAGCAAGACAAGGAGGAGGCAGG + Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065681792 10:28242849-28242871 CAGGAAGAGGAGGAGGGGAGAGG + Intronic
1065790301 10:29254351-29254373 GAGGAAGAGGAGGAGGAGGATGG + Intergenic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1066978689 10:42391830-42391852 CAGGTGGAGGAGGAGGAGTGGGG + Intergenic
1067262468 10:44706347-44706369 CAGATAGAGCAGGAGGACTATGG + Intergenic
1067558167 10:47286648-47286670 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1067770116 10:49116562-49116584 CTGTAGGAGGAGGAGGAGACAGG + Intergenic
1067820418 10:49524089-49524111 GAGAAGGAGGAGGAGGAGGTCGG - Exonic
1067909641 10:50332870-50332892 AAGACAGAGGAGGTGGAGGCAGG - Intronic
1068041042 10:51824734-51824756 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1068117339 10:52749617-52749639 GAGACAGAGGAGGGGGAGTGAGG - Intergenic
1068412668 10:56677743-56677765 AAGGAAGAGGAGGAGGAAGCAGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068599797 10:58944642-58944664 CAGAAACAGAAGGAAGAGTATGG - Intergenic
1069415811 10:68199983-68200005 CAGAATGAGTAGGAGGTGCCAGG - Intronic
1069940382 10:71951449-71951471 CAGGAAGGGAAGGAGGAGTCTGG + Intergenic
1070148445 10:73791227-73791249 CAGCAAGAGGAGGATGAGGCAGG - Intronic
1070205145 10:74251278-74251300 AAGAGAAAGGAGGAGGAGTAGGG + Intronic
1070687027 10:78492654-78492676 CAGAAAGAGGAGGCAGAGACTGG + Intergenic
1070704600 10:78628640-78628662 CAGAAGTATGAGGAGCAGTCTGG - Intergenic
1070741667 10:78907463-78907485 AAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071102650 10:82057305-82057327 CAGAAATTGGAGTAGGAGTTAGG - Intronic
1071203812 10:83251730-83251752 GAGGAAGAGGAGGAGGAGGGAGG + Intergenic
1071238445 10:83677095-83677117 CACAAACAGGAGGAGGAATCTGG + Intergenic
1071256855 10:83878955-83878977 CAAAAAGAGGAGGATGGCTCAGG + Intergenic
1071348308 10:84714562-84714584 TAGAAAGAGGAAGAGGAGAGAGG + Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1072407854 10:95171146-95171168 CAGAACAAGGAGGAAGAATCAGG + Intergenic
1072461675 10:95624629-95624651 GAAAAAGAGGAGAAAGAGTCAGG + Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072785000 10:98273404-98273426 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1073056747 10:100707987-100708009 CCAAAAGAGGAGGAGGAGTGAGG + Intergenic
1073067999 10:100775235-100775257 GAGAAAGAGGAGGAGGAACATGG + Intronic
1073099231 10:100998295-100998317 CAGAAAGAGGAGGAGGCTCTCGG + Intronic
1073249851 10:102114746-102114768 GAGAAGGAGGAGGAGGAGAGAGG - Intronic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073439339 10:103543496-103543518 GAGGAAGAGGAGGAGGAGGGAGG - Intronic
1073502151 10:103949937-103949959 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1073513888 10:104060363-104060385 AAGAAAGAGAAGGAGGAGGGAGG + Intronic
1073795893 10:106988013-106988035 GAGAGAGAGGAAGATGAGTCTGG - Intronic
1073941192 10:108700369-108700391 GAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1073956627 10:108879424-108879446 CAGCAAGGGCAGGAGCAGTCAGG - Intergenic
1074223368 10:111460181-111460203 TAGAAAGAGGACAAGGAGTCTGG - Intergenic
1074560270 10:114529416-114529438 TAGAAAGAGGATGAAGAGGCCGG - Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075166422 10:120071951-120071973 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1075288177 10:121205021-121205043 CAGACAGAGGTGGAGGTGGCAGG - Intergenic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1076318935 10:129564354-129564376 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1077239460 11:1502949-1502971 GACAAAGAGGAGGAGGGCTCTGG + Intergenic
1077542350 11:3153011-3153033 CAAGGAGAAGAGGAGGAGTCTGG + Intronic
1078361982 11:10676191-10676213 CAGAAAGTGATGGAGGAGTGAGG + Intronic
1078366401 11:10710179-10710201 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1078461015 11:11515443-11515465 CAGAGAGAGCAGGGGGAATCGGG - Intronic
1078580219 11:12533816-12533838 GAGGAGGAGGAGGAGGAGTAGGG + Intergenic
1078652883 11:13212389-13212411 CTGAAAGAGGAGGAGGTATGTGG + Intergenic
1078748696 11:14139760-14139782 CATAAAGAGGATTAGGAGTAGGG + Intronic
1078776223 11:14396123-14396145 CAGAAAGTGCAAGATGAGTCTGG + Intergenic
1079109783 11:17598863-17598885 CAGAAAGAACACTAGGAGTCAGG - Intronic
1079151200 11:17901056-17901078 CAGAAATAGGAGGATCAGTAAGG - Intronic
1079166084 11:18044727-18044749 CTGAAAGAGTAGGAGGAGGTGGG - Intergenic
1079250034 11:18780519-18780541 CACAAAGAGGAGGAGCAGGAAGG - Intronic
1079317536 11:19421915-19421937 CAGCAAGAAAATGAGGAGTCAGG - Intronic
1079360305 11:19765418-19765440 AAGAAGGAGGAGGAGGAGAGAGG - Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079410485 11:20182853-20182875 CAGACAGAAGAGGAGAAGGCTGG - Intergenic
1079512961 11:21232480-21232502 AAGAAAGAGGAGGAGGAGGTTGG + Intronic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079703937 11:23589050-23589072 GAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1080005339 11:27400322-27400344 CAAAAAAAGCAGGAGGAGTAGGG - Intronic
1080329485 11:31119021-31119043 CACAAAGAGGAGGAGGAGTGGGG + Intronic
1080550366 11:33369189-33369211 GAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1080648884 11:34207187-34207209 TGGAGAAAGGAGGAGGAGTCAGG - Intronic
1080786883 11:35483527-35483549 GAGAAGGAGGAGGAGAAGACAGG - Intronic
1080882197 11:36332742-36332764 CAGCAGGAGGAGGAGGTGCCAGG - Intronic
1081441252 11:43083959-43083981 GAGGAGGAGGAGGAAGAGTCAGG + Intergenic
1081568745 11:44276527-44276549 AAGAAAGAAGAGGTGGAGGCTGG + Intronic
1081592879 11:44437233-44437255 CACACAGAGGAGGTGGGGTCAGG - Intergenic
1081638640 11:44737860-44737882 CCAAAGGATGAGGAGGAGTCAGG - Intronic
1081692268 11:45086576-45086598 CGGAGAGAGCAGGAGGAGGCCGG - Intergenic
1081871963 11:46387075-46387097 AAGCAAGAGGAGGAGGAGAGTGG + Intergenic
1082160320 11:48882676-48882698 CAGAGAGACCAGGGGGAGTCTGG - Intergenic
1082162046 11:48897730-48897752 CAGAGAGACCAGGGGGAGTCTGG + Intergenic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1082286449 11:50322921-50322943 GTGAAAGAGGAAGAGGAGTCAGG - Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1083417773 11:62536428-62536450 CAGAGAGAGGCGGAGGTGACGGG - Intronic
1083540539 11:63508948-63508970 GAGAAAGAGGATGAGGAAGCTGG - Exonic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083571446 11:63764037-63764059 GAGGAGGAGGAGGAGGAGTGGGG - Exonic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083692522 11:64419100-64419122 CACAGACAGGAGGAGGAGTTGGG - Intergenic
1083883776 11:65560814-65560836 CAGGGAGAGGAGGCGGAGTCAGG + Intergenic
1083883782 11:65560837-65560859 CAGGGAGAGGAGGCGGAGTCAGG + Intergenic
1084201006 11:67558328-67558350 CAGAGAGAGCAGGGGGAGCCTGG - Intergenic
1084266936 11:68010024-68010046 CAGCCTGAGGAGGAGGAGTGGGG - Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084530172 11:69722569-69722591 GAGAAGGAGAAGGAGAAGTCAGG - Intergenic
1084559152 11:69892983-69893005 GAGAAACAGGGTGAGGAGTCGGG + Intergenic
1085192258 11:74637585-74637607 CAGAAAGAGGAGGAAAAAACTGG - Intronic
1085206527 11:74736657-74736679 CAGCAAGAGGAGGAAGTATCAGG + Intergenic
1085362491 11:75903093-75903115 AAGAGAGAGGAGGAGGAGGAAGG - Intronic
1085520025 11:77132242-77132264 CAGAGAAAGGAGGAGGACTGTGG - Intronic
1085849769 11:80106468-80106490 AAGAAAGAGGGGGTGGAGTTGGG + Intergenic
1086572886 11:88305399-88305421 AAGAGAGAGCAAGAGGAGTCTGG + Intronic
1086598182 11:88600238-88600260 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1087219514 11:95531245-95531267 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1087272901 11:96129764-96129786 GGGACAGAGGAGGAGGAGTAAGG - Intronic
1088070140 11:105773108-105773130 AAGAATGAGAAGGAGGAGTAGGG - Intronic
1088124231 11:106404437-106404459 AAGAGAGAGGAGGAGGCATCAGG - Intergenic
1088134857 11:106542744-106542766 AAGAAAGAAAAAGAGGAGTCTGG - Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1089058787 11:115608996-115609018 CAGAATGAGGAGGAGGGCACAGG - Intergenic
1089083650 11:115798605-115798627 CAGGAAGAGGAGGAGGACGGGGG - Intergenic
1089417684 11:118306193-118306215 AAGAAGGAGGAGGAGGAGAAGGG + Intronic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089601444 11:119617818-119617840 CTGACAGAGAAGGAGGAATCAGG - Intergenic
1089826464 11:121282181-121282203 AAGGAAGAGGAGGATGATTCAGG - Intergenic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1090862449 11:130666130-130666152 AAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1090976841 11:131686514-131686536 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1091142669 11:133249302-133249324 GAGAAAGGGGAGGAGGTGCCAGG + Intronic
1091146091 11:133281689-133281711 CAGGAAGATGAGGAGAAGTTTGG + Intronic
1091183034 11:133624595-133624617 CAGAAAAAGATGGTGGAGTCTGG - Intergenic
1091632810 12:2174956-2174978 TAGGAAGAGGAGGAGGAGGAGGG + Intronic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1091962918 12:4714021-4714043 CAGAACGTGGAGGCGGAGGCGGG - Intronic
1092602774 12:10084344-10084366 CCGATAGAGGAGGACCAGTCTGG + Intronic
1092701271 12:11233704-11233726 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1092973889 12:13725336-13725358 AAGAGGGAAGAGGAGGAGTCAGG + Intronic
1093025208 12:14239514-14239536 CAGAAAGAGGAGCAGGCGTAGGG + Intergenic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093844525 12:23952197-23952219 CAGGAAGAGGAGGAGGCGGGAGG + Intergenic
1094030326 12:26004711-26004733 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1094139006 12:27161248-27161270 TTGGAAGATGAGGAGGAGTCTGG + Intergenic
1094740870 12:33287027-33287049 CAAAGAAAGGAGGAAGAGTCTGG - Intergenic
1095296138 12:40529830-40529852 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1095585385 12:43844043-43844065 CAAAAAGAGGAGGCCGAGTATGG + Intronic
1095739307 12:45589802-45589824 CAGAAAGAGGAGTAGGATAGAGG + Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096195154 12:49644908-49644930 CAGAAAGAGGAGACAAAGTCAGG + Exonic
1096561336 12:52437920-52437942 CACAGAGAGTAGGAGAAGTCTGG - Intergenic
1096648526 12:53050653-53050675 AAGAGAGAGGAGAGGGAGTCAGG + Intronic
1097121603 12:56737247-56737269 CAAAGAGAGGGGGAGGAGTTGGG - Intronic
1097357685 12:58620600-58620622 GAGAGAGGGGAGGAGGTGTCAGG - Intronic
1097744092 12:63280576-63280598 GATAAAGAGAAGGAGGAGGCAGG + Intergenic
1097874822 12:64633440-64633462 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098009626 12:66036659-66036681 CAGAAAGAGGTGGTGCAGTGTGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098504853 12:71237609-71237631 AAAAAAGAGGAGGAGGAGGGTGG - Intronic
1098649335 12:72944548-72944570 CAGAAAGATGAGGGAAAGTCTGG - Intergenic
1098740981 12:74172777-74172799 CTAAAAAAGGAGGTGGAGTCTGG - Intergenic
1098948169 12:76610607-76610629 GACAAAGAGGAGGAGGAGGAGGG + Intergenic
1099010235 12:77283210-77283232 CAGAAAGAAGAGGTGGAGGTGGG + Intergenic
1099062861 12:77934094-77934116 CAGAAAGAAAAGGAAGAATCTGG - Intronic
1099109320 12:78537683-78537705 CATATAGAGAAGGAGGAGCCTGG - Intergenic
1099163849 12:79276968-79276990 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1099184453 12:79502727-79502749 CAGAGAGAGGAGGAGATGCCAGG + Intergenic
1099624571 12:85053580-85053602 CAGAAAATGGAGGAAGAGTCAGG - Intronic
1100066516 12:90652758-90652780 AAGAAAGAGGAGCAGGAATATGG + Intergenic
1101043828 12:100784258-100784280 GAGAAAGAGTAGGAGGATTCTGG - Intronic
1101064533 12:101005920-101005942 CTGGAAGAAGAGGAGGAGGCAGG - Intronic
1101830617 12:108253668-108253690 CAGGAAGAGGATGAGGAGATGGG - Intergenic
1101963162 12:109265061-109265083 CGGAAAGGGAAGGAGGAGACGGG - Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102363057 12:112305307-112305329 CAGAGAGAGGAGGAGGGCTTGGG - Intronic
1102408802 12:112698924-112698946 AAGAAGGAGGAGGAGGAGAAGGG - Intronic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1102478971 12:113207793-113207815 CAGAAAGAGGCTGAGGAGGAAGG - Exonic
1102746220 12:115251269-115251291 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746235 12:115251366-115251388 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746249 12:115251457-115251479 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1103005088 12:117414632-117414654 CAGGAAGAGGAGGAGGAAGGAGG - Intronic
1103159618 12:118717991-118718013 GAGAAAGGGGAGGAGGTGTCAGG - Intergenic
1103235392 12:119368216-119368238 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1103391530 12:120577377-120577399 GAGTCATAGGAGGAGGAGTCTGG + Exonic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103546532 12:121705637-121705659 TAGAAAGAGGAGGAGGAAAGAGG + Intergenic
1103736142 12:123062032-123062054 GAGAAGGAGGAGGAGGAGCAGGG - Intronic
1103896629 12:124277707-124277729 GAGGAAGAGGAGGAGGAGAGAGG - Intronic
1103947103 12:124532733-124532755 GAGGCAGAGGAGGAGGAGGCTGG + Intronic
1104085139 12:125467372-125467394 GAGAAAGAGGAGGAGGAGAGGGG - Intronic
1104159381 12:126163792-126163814 AAGAAGGAGGAGGAGGAGAGAGG + Intergenic
1104222541 12:126798901-126798923 CAGAAAGAGGAGGAGTGTTATGG + Intergenic
1104225816 12:126832076-126832098 GAGAAGGAGGAGGAGGAGAAAGG - Intergenic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104698464 12:130882634-130882656 CAGACAGAGGAGGAGTTCTCAGG - Intergenic
1104757358 12:131277474-131277496 CTGCAGGAGGAGGAGGAGTTGGG + Intergenic
1104775688 12:131389000-131389022 CTGCAGGAGGAGGAGGAGTTGGG - Intergenic
1104782775 12:131432515-131432537 CAGGAGGAGGAGGAGGAGAAGGG + Intergenic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1104819068 12:131664515-131664537 GAGGCAGAGGAGGAGGAGCCAGG - Intergenic
1105275563 13:18921092-18921114 TAGAAAGGGGAGGAGGAGCTTGG + Intergenic
1105308269 13:19184078-19184100 CACAAAGAGGAGGAGCAGGGAGG + Intronic
1105373034 13:19817961-19817983 CAGAGAGTGGAGGTGGAGACAGG + Intergenic
1105544874 13:21344014-21344036 AAGGAAGAGGAGGAGGAGGCGGG - Intergenic
1105588298 13:21765350-21765372 CAGAAAGTGCAAGATGAGTCTGG + Intergenic
1105657054 13:22453117-22453139 CAGAAAAAGGAGGCTGAGCCTGG + Intergenic
1105759720 13:23502970-23502992 CAGACAGAGGAGGAGGTCTGTGG - Intergenic
1105977873 13:25489259-25489281 CAGACACAGGAAGAGGAGCCTGG - Intronic
1106385765 13:29283980-29284002 TACAAAGAGGAAGAGGAGTTTGG + Intronic
1106389963 13:29325507-29325529 GAGAAGGAGGAGGAGGAGGGAGG + Intronic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106594303 13:31123524-31123546 CTGGGAGAGGAGGAGGATTCTGG + Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1106928716 13:34640639-34640661 CAGAATGACGCAGAGGAGTCTGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1108020685 13:46124983-46125005 GAGAAAGAAGAGGAGGAGACAGG - Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108207558 13:48106305-48106327 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1108249397 13:48549951-48549973 TTCAAAGAGGAGGAGGAGACAGG - Intergenic
1108282751 13:48876039-48876061 CAGCAAGAAGTGGAGGAGTCGGG + Intergenic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108781139 13:53835572-53835594 AAGAAAGAGGAGGAAGAGGAGGG - Intergenic
1109012500 13:56969945-56969967 CACACAGAAGAGGAGGGGTCAGG - Intergenic
1109024049 13:57138410-57138432 CAGAAAGGTGAGGATGAGCCAGG + Intergenic
1110153007 13:72277466-72277488 CAGAAAGAGTAGGTGGAGAGAGG - Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1110588446 13:77223349-77223371 GAGAAAGAGAAGGAAGAATCGGG - Intronic
1110761777 13:79238626-79238648 AAGAAAGAGGAGGAGGAAGAGGG + Intergenic
1110953519 13:81523452-81523474 CAGAAAGAGGAGGAATAGGAGGG - Intergenic
1111179976 13:84651568-84651590 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111448201 13:88378310-88378332 TAGAAAGAGGAGAGGGAGTATGG + Intergenic
1112123358 13:96437468-96437490 CAGAAAGGTGGGGAGGAGACTGG - Intronic
1112403029 13:99092547-99092569 CAGAAAGAAGAGGAGGAATGGGG + Intergenic
1113069162 13:106402838-106402860 GAGAATGAGGAGGAGGAGATAGG - Intergenic
1113159616 13:107365024-107365046 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
1113312914 13:109149714-109149736 GAAAAAGAGGAGGAGAAGGCAGG - Intronic
1113473917 13:110566356-110566378 AAGAAAAGGGAGGAGGAGACGGG + Intergenic
1113611400 13:111647071-111647093 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1113909679 13:113836254-113836276 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1114269079 14:21090582-21090604 CAGGAAGGGGAGGAGGGCTCCGG - Exonic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114519112 14:23321755-23321777 CAAGAGGAGGAGGAGGAGCCGGG + Exonic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114646604 14:24259622-24259644 CAGAAAGGGCAGGAGGAGGGTGG + Intronic
1114667846 14:24391019-24391041 CAAAAAGTGGAGGAGGAGGATGG + Intergenic
1115221650 14:31064143-31064165 CTGAATGAGGAGGATGAGTTAGG + Intronic
1115275594 14:31605788-31605810 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1115903650 14:38183185-38183207 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1115908890 14:38233501-38233523 CAGAAATAAAAGGAGCAGTCTGG + Intergenic
1116876803 14:50120313-50120335 GAGGAAGAGGAGGAGGAATCAGG + Exonic
1116907490 14:50418346-50418368 CAGTAAGAAAAGGAGGATTCTGG + Intergenic
1116975350 14:51109799-51109821 GAGACAGGGGAGGAGGAGCCAGG + Intergenic
1116992022 14:51286717-51286739 CAGGGAGATGAGGAGGAGTCGGG - Intergenic
1117119534 14:52552957-52552979 GGGAAAGAGGAGGCGGGGTCCGG + Intergenic
1117316933 14:54580328-54580350 CAGAAAGGGGTGGGGGAGTCTGG - Intronic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118081003 14:62360789-62360811 CAGAAAGAGAAAGAGGATTATGG + Intergenic
1118084966 14:62404181-62404203 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1118128578 14:62937006-62937028 AAGAAAGAGGAGGAGAAGGAAGG + Intronic
1118171699 14:63395446-63395468 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1119067339 14:71542236-71542258 GAGGAGGAGGAGGAGGAGCCAGG - Intronic
1119180363 14:72600984-72601006 GAGGAAGAGGAGGAGGAGGGGGG + Intergenic
1119387376 14:74266074-74266096 GGGAAAGATGAGGAGGAGTCTGG + Intergenic
1119484287 14:74978005-74978027 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1119996832 14:79262441-79262463 GAGAAAGAGGAGGAGGAAGGAGG + Intronic
1120167973 14:81220678-81220700 CGGAGAGAGGAGGAGGAGGGGGG + Exonic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121083070 14:91124337-91124359 CAGAGAGAAGAGGAGGCATCAGG - Intronic
1121220224 14:92279354-92279376 CAGGAAGAAGGGGAGGAGCCAGG - Intergenic
1121523982 14:94605696-94605718 GAGAAAGACAAAGAGGAGTCAGG + Intronic
1121600157 14:95197419-95197441 AAGAAAGAGGAGGAAGAGAAGGG + Intronic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1121832762 14:97066121-97066143 AAGAAAGAGGAGGAGGAGGGAGG - Intergenic
1121991476 14:98561902-98561924 CAGAGAGGGGTGGAGGAGTCAGG - Intergenic
1122015541 14:98792346-98792368 GAAAAATAGGAGGAGGAATCAGG + Intergenic
1122204793 14:100143058-100143080 GACATAGAGGAGGGGGAGTCCGG + Intronic
1122317285 14:100833614-100833636 CAAAAAGAGGAGGAGGGTTCAGG - Intergenic
1122361608 14:101170368-101170390 CAGAAGGAGAAGGAGCGGTCAGG - Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1122831382 14:104398808-104398830 CAGGGAGAGGAGGAGCTGTCCGG - Intergenic
1122971414 14:105153734-105153756 CAGGAAGATGAGCCGGAGTCTGG - Intronic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124154638 15:27215203-27215225 CTGAAGGAGGAAGAGGAGTCAGG + Intronic
1124473269 15:30007621-30007643 AAAAAAGAGCAGGAAGAGTCTGG - Intergenic
1124563310 15:30794506-30794528 GAGGAGGTGGAGGAGGAGTCGGG - Intergenic
1124587637 15:31024390-31024412 CAGAAAGAGGAGAAGGCTTGAGG - Intronic
1124710787 15:32008347-32008369 AAGAAATAGGAGGAGGAGAAGGG - Intergenic
1124716840 15:32071664-32071686 GAGAGAGAGGAGGAGGTGCCAGG - Intronic
1124831806 15:33156110-33156132 GAGAGAAAGGAGGAAGAGTCTGG + Intronic
1124992741 15:34692025-34692047 AAGAAAGAGAAGCAGGAGACAGG + Intergenic
1125024816 15:35019522-35019544 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1125262155 15:37838920-37838942 CAGAAAGAGGACAAGAAGTCAGG + Intergenic
1125316991 15:38442097-38442119 CAAAGAGAGGCCGAGGAGTCTGG - Intergenic
1125511877 15:40296565-40296587 GAGGAAGAGGAGGAGGAGTCAGG - Exonic
1127108802 15:55645906-55645928 CAGAAAGGGAAGGAGGAGAAAGG + Intronic
1127242657 15:57134917-57134939 CAGGAAAAGGAGGAGGAATGTGG - Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127291955 15:57579109-57579131 CTGGAAGGGGAGGAGGAGTCAGG - Intergenic
1127733578 15:61821350-61821372 CAGAAATAGGAGAAGGCATCAGG - Intergenic
1127879553 15:63144595-63144617 CGGAAAGAGAAGGGGGAGCCCGG - Intronic
1128110368 15:65072214-65072236 CAGGAAGAGGAGGAGGAGATGGG - Intronic
1128129165 15:65214402-65214424 CAGAAAGAGATGGAGGTGACTGG - Intergenic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128750595 15:70146271-70146293 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1128940903 15:71786843-71786865 GAGGAAGGGGAGGAGGAGTAGGG + Intergenic
1129012654 15:72436726-72436748 GTGAGAGAGGAGGAGGAGCCAGG - Intergenic
1129113248 15:73350623-73350645 CAGAAAGAGGAAGGGGACACTGG - Intronic
1129153004 15:73700892-73700914 AAAAAAGAGGAGGAGGAGGAGGG - Intronic
1129496117 15:75982777-75982799 CTGAAAGAGTAGGAGAATTCTGG + Intronic
1129498040 15:76005821-76005843 GAGAAAGAGGAGGAGTTGGCAGG + Intronic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1129522696 15:76195939-76195961 CAGAGAGAGGAGGAGCAGGAGGG - Intronic
1129591634 15:76920340-76920362 CAGACTGAGGAAGAGGATTCAGG + Intergenic
1129816692 15:78561669-78561691 CTGAAGGAGGAGTAGGAGTTAGG + Intergenic
1130127427 15:81105409-81105431 AAGAAAGAAGAGAAGGAGTGAGG - Intronic
1130226106 15:82059191-82059213 GAGGAAGAGGAAGAGGAGTGGGG - Intergenic
1130748909 15:86688255-86688277 GAGAAAGAGGAGGAGGAGAAGGG + Intronic
1130871971 15:87978796-87978818 CGGTAAGAGGAGGGGGAGCCAGG - Intronic
1130878142 15:88032087-88032109 CAGGAAGAGTAGGAGGAGCGGGG + Intronic
1130880476 15:88051284-88051306 GAGAAAGAGGAGGGAGAGTTAGG - Intronic
1130944559 15:88541303-88541325 CTCAAAGAGGAGGATGTGTCAGG - Intronic
1131139824 15:89968112-89968134 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
1131206160 15:90449580-90449602 CAGAAGGAGGAGCTGCAGTCTGG + Exonic
1131224413 15:90612022-90612044 GAGGAGGAGGAGGAGGAGTGGGG - Intronic
1131776138 15:95800935-95800957 CAGAAAGATGAGAAGGAGCATGG + Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131852133 15:96554692-96554714 GAGGAAGAGGAGGAGGAGGGAGG - Intergenic
1131854860 15:96582763-96582785 CCGAAAGAGGCAGAGGTGTCAGG + Intergenic
1131861797 15:96661610-96661632 CAGAAAGACTACGAGGAGGCAGG + Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132198696 15:99932988-99933010 GAGAAAGGGGAAGAGGAGCCAGG - Intergenic
1132314630 15:100880565-100880587 CAGAACGAGGAGGAGTAGGAAGG + Intronic
1132490116 16:223916-223938 CGGGAGGAGGAGGAGGAGGCGGG - Intronic
1132651577 16:1023596-1023618 CCGGAAGAGGAGAAGGAGCCAGG - Intergenic
1132764432 16:1527059-1527081 GGGAAAAAGGAGGAGGAGCCTGG - Intronic
1132857822 16:2054880-2054902 GAGAAAGAGGAGGAAGAGATCGG + Intronic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133453352 16:5921828-5921850 GAGCAAGAGGGGGAGGAGCCAGG + Intergenic
1133460674 16:5983927-5983949 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133777864 16:8911844-8911866 CAGCAAGAGGATGAGGATTGGGG + Intronic
1133838235 16:9385481-9385503 GAGAAAGAGAAGGAGGGGCCGGG - Intergenic
1133874744 16:9723201-9723223 GAGGAAGAGGAGGAGGAGACAGG + Intergenic
1134057162 16:11177781-11177803 GAGGAGGAGGAGGAGGAGACAGG + Intronic
1134208795 16:12259046-12259068 GAGAGAGAGGAGGGGGAATCTGG - Intronic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134912721 16:18042601-18042623 AGGGGAGAGGAGGAGGAGTCAGG - Intergenic
1135163703 16:20120173-20120195 GAGAAAGAGGTGGAGGAGGGAGG - Intergenic
1135203750 16:20464179-20464201 CAGAAAGATGAGGAAAAGTTCGG - Intronic
1135354817 16:21760300-21760322 CCCAAAGAGGAGGAGGGGTGGGG - Intronic
1135453301 16:22576442-22576464 CCCAAAGAGGAGGAGGGGTGGGG - Intergenic
1135612867 16:23883584-23883606 CAGAAGTGGGAGGATGAGTCAGG + Intronic
1135727543 16:24868814-24868836 GAAAAAGAGGAGGAGGAGGAAGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135964671 16:27025731-27025753 CTCAAATAGGAGGTGGAGTCTGG + Intergenic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136178094 16:28532370-28532392 GAGACAGAAGAGGAAGAGTCTGG + Intergenic
1136617180 16:31405279-31405301 AAGAAAGAGAAGGAAGAGGCTGG - Intronic
1137405707 16:48187594-48187616 CAGCAGTAGGTGGAGGAGTCAGG - Intronic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557129 16:49477565-49477587 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557150 16:49477671-49477693 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557161 16:49477739-49477761 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137673573 16:50292859-50292881 CAGAAAGAGGAAGAGGACAGGGG - Intronic
1137754850 16:50893102-50893124 CAGACATAGGAGGAAGAGGCAGG + Intergenic
1137778461 16:51076460-51076482 AAGAAAGAGAAGGAACAGTCAGG - Intergenic
1137830311 16:51537921-51537943 CTGAATTAGAAGGAGGAGTCTGG - Intergenic
1137847788 16:51709083-51709105 GTGAGGGAGGAGGAGGAGTCGGG + Intergenic
1138222959 16:55268640-55268662 GAGACAGCTGAGGAGGAGTCTGG - Intergenic
1138240684 16:55424837-55424859 GAGAAAGAGAAGGAGGAGTAGGG - Intronic
1138275894 16:55734502-55734524 AAGAAAGATAAGGTGGAGTCAGG - Intergenic
1138293869 16:55870359-55870381 GAGGAAGAGGAGGAGGAGAAAGG + Intronic
1138421605 16:56902761-56902783 GAGGAGGAGGAGGAGGACTCCGG - Intronic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139691342 16:68643917-68643939 CAGAAGGTGAAGGAGGAGTGAGG + Intronic
1140024277 16:71270258-71270280 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1140351972 16:74271111-74271133 CAGAAAGAGGAGCTGGACCCTGG + Intergenic
1140685077 16:77425744-77425766 CAAAAAGAGGAGGAGTGGGCCGG + Intronic
1140903634 16:79392435-79392457 AAGAGAGAGGAGGAGGAGAAGGG + Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141046941 16:80723860-80723882 GAGAAAGAGGAGGAAGAGGAAGG + Intronic
1141047007 16:80724260-80724282 GAGGAAGAGGAGGAGGAGAAAGG + Intronic
1141107581 16:81246195-81246217 CAGTCAGAGGAGGAGGTGTGAGG - Intronic
1141155527 16:81594077-81594099 GAGGAAGAGGAGGAGGAGCGGGG - Intronic
1141198943 16:81882627-81882649 AAGAAAGAGGAGTAGGAGCGAGG - Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141775567 16:86120891-86120913 GAGGAAGAGGAGGAGGAGAAGGG - Intergenic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141775801 16:86121890-86121912 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1141818930 16:86431945-86431967 CCGAGAGAGGAGCATGAGTCAGG - Intergenic
1141953295 16:87353177-87353199 CTGAAAGTGGAGGAGGACCCAGG - Intronic
1141990169 16:87604782-87604804 CCCGAAGAGGAGGAGGAGTCTGG + Intronic
1142005116 16:87686001-87686023 GAGACAGAAGAGGAGGAGACAGG + Intronic
1142148116 16:88501001-88501023 CAGGAGGAGGTGGAGAAGTCAGG - Intronic
1142554847 17:766934-766956 AAGAGCGAGGAGGAAGAGTCTGG + Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143036294 17:4001156-4001178 GAGGAAGAGGAGGAAGAGGCAGG + Intergenic
1143054646 17:4153776-4153798 GATGTAGAGGAGGAGGAGTCAGG + Intronic
1143165418 17:4895048-4895070 CAGAAGGAGGAGGAGGTGGGAGG - Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143255902 17:5557960-5557982 CAGAGAGAGGAGCAGGGGTAGGG + Intronic
1143391543 17:6561692-6561714 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1143471231 17:7177327-7177349 CTGCAAGAGGAGGGGGTGTCAGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1144140051 17:12339548-12339570 CATAAAGAGATGGAGGAGGCCGG - Intergenic
1144343664 17:14331549-14331571 CTGGAAGAGGAGGAGGGCTCGGG + Intronic
1144438290 17:15260710-15260732 CAGCAACAGGAGGAGCATTCTGG + Exonic
1144580527 17:16456490-16456512 GAGGAAGAGGAGGAGGAAGCTGG + Intronic
1144712220 17:17409332-17409354 AAAAAAAAGAAGGAGGAGTCAGG - Intergenic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145779900 17:27555922-27555944 CAGAAAGATGAGCAGGCTTCAGG - Intronic
1145921630 17:28614164-28614186 CAGAGAGAGGAGGCAGAGGCTGG - Exonic
1146187085 17:30731244-30731266 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146332120 17:31936604-31936626 CAGAAAGCTGAGAAGGAATCCGG - Intergenic
1146380312 17:32322921-32322943 CAGAAACAGGGGCAGGAGTGTGG + Exonic
1146595069 17:34161576-34161598 CAGCAGGAGGAGGAGGCCTCAGG - Intronic
1146644005 17:34564370-34564392 CAGGAAAATGAGGAAGAGTCAGG - Intergenic
1147193117 17:38748497-38748519 CGGGAAGAGGAGGGGGAGGCTGG + Intronic
1148025606 17:44585542-44585564 CAGAAAGAGGAGGTGGCAGCAGG - Intergenic
1148271460 17:46265401-46265423 TAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1148389164 17:47257909-47257931 CACAGTGAGGAGGGGGAGTCTGG + Intronic
1148539708 17:48470609-48470631 AAAAAAGAGGAGGAGGAGCAAGG - Intergenic
1148589047 17:48801672-48801694 CAGGAAGTGGGGGAGGAGTATGG + Intronic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1149066423 17:52485921-52485943 CAGGAGGAGGAGGAGGAGATGGG - Intergenic
1149114172 17:53071751-53071773 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1149456564 17:56793026-56793048 AAGAAGGAGGAGGAGGAGAGGGG + Intronic
1149485827 17:57042074-57042096 GAAAATGAGGAGGAGGAATCCGG + Intergenic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1150643098 17:66962875-66962897 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1150853846 17:68731822-68731844 CCGAAAGAGGAGGAGCAGCAAGG + Intergenic
1151077937 17:71295900-71295922 GAGAGAGAGGAGGAGGTGCCTGG + Intergenic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151331285 17:73410727-73410749 CAGAAACTGGTGGAGGAGTAAGG - Intronic
1151383907 17:73743723-73743745 GAGAAAGAAGAGGAGGAGGAGGG - Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151714218 17:75823280-75823302 AAGAAAGAGGCGGAGGAGGCTGG + Exonic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152132451 17:78485372-78485394 GAGACAGAGGAGGAGCAGCCGGG - Intronic
1152188540 17:78874113-78874135 TGGAAGGAGGAGGAGGAGGCTGG - Intronic
1152508500 17:80769713-80769735 CAGCAAGAGGAGGTGGAGAAAGG + Intronic
1152556354 17:81055075-81055097 CAGGAAGCGGTGGAGGAGCCGGG - Intronic
1152800791 17:82329832-82329854 GGGAGAGAGGAGGGGGAGTCAGG - Intronic
1152949655 17:83221544-83221566 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1203161717 17_GL000205v2_random:58053-58075 CAGAAAGAAGAGGAGAACTTCGG - Intergenic
1153170687 18:2312498-2312520 AAGGAAGAAGAGGAGGAGTGGGG + Intergenic
1153185227 18:2478801-2478823 GAGAAAGAGGAGGAGGAAGAAGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153873302 18:9340995-9341017 GAGGAAGGGGAGGAGAAGTCAGG - Intronic
1154031389 18:10756798-10756820 GAGAATGAGGAGGAGGAATGGGG + Intronic
1154162467 18:11990407-11990429 GAGAGAGAAGAGGAGGGGTCGGG + Intronic
1155066207 18:22271210-22271232 GAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1155066654 18:22274124-22274146 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1155350036 18:24897342-24897364 AAAAAAGAGGAGGAGGAGAAGGG - Intergenic
1155555120 18:27010541-27010563 CAGGAAGTAGAGGAGGAGTTAGG - Intronic
1156154797 18:34288683-34288705 CAGAAAGATGAGGAAAAGTTTGG - Intergenic
1156213630 18:34975206-34975228 CAGAGAGAGAAGGAGAAGTAAGG + Intergenic
1156229691 18:35141237-35141259 CACAAAGAGGAAGAGGAATGAGG - Exonic
1156627284 18:38924418-38924440 AAGAAAGAGAAGGAGAGGTCAGG + Intergenic
1156791769 18:40984132-40984154 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1156825894 18:41429802-41429824 CAGCCAGAGGAGGAGAAATCCGG - Intergenic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157382022 18:47227170-47227192 GAGAAGGAGGAGGAAGAGGCAGG - Intronic
1157426979 18:47592480-47592502 CAGGAGGATGAGGAGGAGTGGGG - Intergenic
1157602881 18:48905098-48905120 AAGAAAGAGAAGGAGGAGAAAGG + Intergenic
1158052557 18:53241145-53241167 CAGAGAGATGAGGAGGTGTAAGG + Intronic
1158073950 18:53506868-53506890 AAAAAAAAGGAGGAGGAGTGTGG + Intronic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158963812 18:62606959-62606981 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1159079802 18:63724315-63724337 CAGAAGGATGAGGAGGATTGGGG - Intronic
1159107207 18:64016092-64016114 CAGAAAGAGGGCTGGGAGTCTGG + Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159446844 18:68551267-68551289 AAGAAAGAGGAAGAGGAGGAAGG + Intergenic
1159502803 18:69295431-69295453 CAGAAAGAAGAGAAGGAGCAAGG + Intergenic
1159730273 18:72017662-72017684 GAGAAGGAGGAGGAGAAGTTGGG - Intergenic
1160045795 18:75386219-75386241 TAGAAAGAGGAGCAGGAGAGAGG - Intergenic
1160073130 18:75645664-75645686 CAGAAGAATGAGGAGGATTCCGG + Intergenic
1160231357 18:77052037-77052059 CTGGAAGAGGATGAGGAGGCTGG + Intronic
1160557273 18:79734387-79734409 CAGAAAGAGGGAGAGGAGATCGG + Intronic
1160682286 19:417330-417352 CAGAAAGAGAAGGCGAGGTCAGG + Intronic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160716266 19:578203-578225 CGGAGAGGGGAGGAGGCGTCTGG - Intronic
1160804418 19:985741-985763 GAGAACCAGGAAGAGGAGTCGGG - Intronic
1161014700 19:1977958-1977980 GAGAAAGGGGTGGAGGAGTGTGG + Intronic
1161112441 19:2477747-2477769 GAGGAAGAGGAGGAGGAGAAGGG + Exonic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161395510 19:4043078-4043100 CAGGAAGAGCAGGAAGGGTCGGG + Intergenic
1161458279 19:4381026-4381048 CAGAGAGAGGGAGAGGAGGCCGG - Intronic
1161635116 19:5383649-5383671 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1162435250 19:10654342-10654364 GAAGAGGAGGAGGAGGAGTCCGG - Exonic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163463080 19:17450702-17450724 AAGGAAGAGGAGGAGGAGGAGGG - Intronic
1163622502 19:18369291-18369313 GAGAAAGAGCAGGAGGAGAAAGG - Exonic
1163827873 19:19533634-19533656 GAAAAAGAGGAGGAGGGGTGAGG - Intronic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164188314 19:22892764-22892786 GAGGAAGAGGAGGAGGAGGGGGG - Intergenic
1164292166 19:23878693-23878715 GAGAAGGAGGAGGAGGAGTAAGG + Intergenic
1164630756 19:29760165-29760187 GAGTAAGAGGAGGAAGTGTCCGG + Intergenic
1164685580 19:30164449-30164471 AAGAGAGAGGAGGAGGTGCCTGG - Intergenic
1164794294 19:31014024-31014046 GAGAAAGAGGAGGGAGAGTCTGG + Intergenic
1164795358 19:31022483-31022505 CAGAAAGAGGAAGAAGAGGGAGG - Intergenic
1164858638 19:31544969-31544991 GAGAAAGAGAAGGAGGAGGAGGG - Intergenic
1164866838 19:31611441-31611463 CAGAAAGAGGGAGAGGAGAGAGG + Intergenic
1165079280 19:33298434-33298456 CAGGACCAGGAGGAGGACTCGGG + Intergenic
1165119597 19:33550672-33550694 CAAAAAGAGGAGGTGCAGGCTGG + Intergenic
1165205621 19:34182920-34182942 TAGAAAGAGGAGGGGGAGAGGGG - Intronic
1165336769 19:35176003-35176025 CAGAGAGAGGGGGAGGTGCCAGG - Intergenic
1165344167 19:35233313-35233335 CAGAAAGTGGAAGAAGAGGCAGG + Intergenic
1165395828 19:35563163-35563185 CAGAAAGGGGAGGAGGAGAGAGG - Intronic
1165600980 19:37055806-37055828 AAGAAACAGCAGGCGGAGTCTGG + Intronic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165690924 19:37862550-37862572 GAGGAAGAGGAGGAGGGGTGGGG + Intergenic
1165740981 19:38205166-38205188 CGGAAGGATGAGGAGGAGACTGG + Intronic
1165951432 19:39475779-39475801 CAGGAAGAGGAGCAGGTGTGGGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166652187 19:44582857-44582879 GAGGAAGAGGAGGAGGAGGACGG + Intergenic
1166900333 19:46056655-46056677 CAGAGAGACGAGGAGGAGTCAGG + Intronic
1167056071 19:47112362-47112384 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1167139215 19:47638113-47638135 AAGAAAGAGCAGGAGGAGGAGGG - Intronic
1167249175 19:48391560-48391582 GAGCGAGAGGGGGAGGAGTCCGG + Intergenic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167383987 19:49153511-49153533 GAGGAAGAGGAGGAGGAGGAGGG - Exonic
1167504773 19:49865430-49865452 CAGAAAGAGAGGGAGGAGCTGGG + Intronic
1167604928 19:50476570-50476592 CAGCAAGAGCAGGAGCAGCCGGG - Exonic
1168337631 19:55605524-55605546 CGGAAAGAGGAGGCGGTGGCGGG - Intronic
1168408130 19:56121196-56121218 AGGAGAGAGGAGGAGGAGTGCGG - Exonic
1168431306 19:56283166-56283188 CAGAAAGAGGTGGTAAAGTCTGG - Intronic
1168489661 19:56797644-56797666 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1168510131 19:56967270-56967292 GAGAAAGAGGAGGAAGAGGAGGG - Intergenic
1168598001 19:57694657-57694679 CAGAATGTAGAGGAGGGGTCAGG - Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925611301 2:5705558-5705580 GAGAAAGGGGTGGAGGAGTAGGG + Intergenic
925718788 2:6808785-6808807 GAGAAAGGGGAGGAGGAGGGAGG + Intergenic
925735222 2:6958008-6958030 CAGAATGGGGTGGGGGAGTCGGG + Intronic
925752430 2:7101044-7101066 AAGGAGGAGGAGGAGGAGACAGG - Intergenic
926141649 2:10371659-10371681 TAGAGGGAGGAGGAGGAGTTTGG - Intronic
926189232 2:10715394-10715416 GAGAAAGAAGAGAAGGAGTGTGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926721759 2:15966240-15966262 CAGAAAGAGGTGGAGGCGGTGGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926928412 2:18011867-18011889 AAGAAAGAGGAGGAGAATACTGG - Intronic
927139100 2:20117865-20117887 CTGGAAGAGCAGGAGGAGCCCGG + Intergenic
927187353 2:20491313-20491335 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
927805066 2:26139750-26139772 CAGAGACAGCAGGAAGAGTCTGG + Intergenic
928141294 2:28731600-28731622 CAGGTAGAGGAGGAGGACCCAGG + Intergenic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
928359487 2:30651518-30651540 CTGAAAGACAGGGAGGAGTCGGG + Intergenic
928921337 2:36531354-36531376 AGGAAAGAGGAGGAAGAATCTGG + Intronic
929026406 2:37607585-37607607 GAGAAAGAGGTGGAAGAGGCAGG + Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929575067 2:43046352-43046374 CGGAAAGAGGAGGAGGAAACGGG + Intergenic
929587521 2:43125808-43125830 GAGCTAGAGGAGGAGGAGCCAGG - Intergenic
930031087 2:47058475-47058497 CAGAAAGAGGTGGAGAAACCAGG - Intronic
930506191 2:52285321-52285343 CAGAAAGATGAGGAAAAGTTTGG - Intergenic
930671949 2:54160587-54160609 CAGAAAGAGAAGGTGGAATAAGG + Intronic
931007196 2:57865234-57865256 AAGAAAGAGGAAGAGGAGAATGG + Intergenic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931534301 2:63255538-63255560 CAGAGAGAGGAGGAGGACCCAGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931644770 2:64411924-64411946 CTGGCAGAGGAGGAAGAGTCAGG - Intergenic
931753080 2:65347812-65347834 TAGAAGGATGAGGAGGTGTCAGG - Intronic
931874311 2:66495730-66495752 CAGCAAGAGGAGGCTGAGACAGG + Intronic
932072760 2:68637237-68637259 CAGATAGAGGAGGAGGTGGGAGG + Intergenic
932213997 2:69954589-69954611 CAGAGACAGGAGGAGAAGACGGG - Intergenic
932387669 2:71352178-71352200 TATAAAGAGGAGGAGGGGGCCGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932814309 2:74849577-74849599 CAGAAAGAGAAGGAATAGTTTGG + Intronic
933166823 2:79085783-79085805 CTGGAAGAGGAGGAGGAATTCGG - Intronic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933496248 2:83053635-83053657 GAGAAAGAGGAGGAGGAAGAGGG + Intergenic
933768757 2:85729692-85729714 CAGGAAGAGGCTGAGAAGTCCGG + Intergenic
934057211 2:88261459-88261481 CAGAAAGTGAAGGAGGACTAAGG - Intergenic
935024317 2:99261628-99261650 CAGACAGTGGAGGAGCAGGCAGG + Intronic
935196143 2:100818278-100818300 AAGAAAGAGGAGGAGGCATTTGG - Intergenic
935371084 2:102347573-102347595 CTGAAAGATGAGTAGGATTCAGG - Intronic
935488384 2:103686607-103686629 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
935505604 2:103898381-103898403 AAGAGAAAGAAGGAGGAGTCTGG + Intergenic
935531701 2:104240509-104240531 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
935750009 2:106223581-106223603 GAGAAAGAGGAGGAGGGGCCAGG + Intergenic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
935942249 2:108252848-108252870 AAGAAAAAGGAGGAGAAGTAGGG + Intronic
936143985 2:109966927-109966949 CAGACAGGGGATGAGGACTCAGG - Intergenic
936180667 2:110264888-110264910 CAGACAGGGGATGAGGACTCAGG - Intergenic
936200702 2:110404542-110404564 CAGACAGGGGATGAGGACTCAGG + Intronic
936607324 2:113971644-113971666 CGGAAAGATGACTAGGAGTCTGG + Intergenic
936697265 2:114965680-114965702 CAGAAAGATAAAGAGGAGGCCGG + Intronic
936731258 2:115384138-115384160 GAGAAAGAGGAGCAGAAGACAGG - Intronic
936926541 2:117742713-117742735 CAGGAAGAGGAGGAGGAGCAAGG + Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937338775 2:121077679-121077701 CAGCAGGTTGAGGAGGAGTCGGG + Intergenic
937618595 2:123958101-123958123 GAGAAAGAAGAGGAGGGGTCTGG - Intergenic
937814024 2:126231524-126231546 CAGAAGGAGGGGGAGGAGAATGG - Intergenic
937868711 2:126772499-126772521 CAGAAGGAGAAGGGGGAGCCAGG + Intergenic
938386222 2:130869200-130869222 CAGAGAGAGTAGGAGGAGTAAGG + Intronic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939683311 2:145166498-145166520 TAGAAAGAGGAGGTGGAGGGGGG - Intergenic
939690443 2:145253926-145253948 CAGGAAGAGGAGGAGAGGTTGGG - Intergenic
939888508 2:147707684-147707706 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
940203784 2:151180145-151180167 CAGGAAGGGCAGGAGGAGTGTGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940619719 2:156096388-156096410 ATGAAAAAGGGGGAGGAGTCTGG + Intergenic
941918747 2:170828917-170828939 CAGAGAGATGAGGAGGGGTGAGG - Intronic
942043738 2:172087246-172087268 AAGAAGGAGGAGGAGGAGGGAGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942241134 2:173964753-173964775 GGGAAAGAGGAGGAGGAGGAGGG - Intronic
942525261 2:176846332-176846354 GACAAAGGGAAGGAGGAGTCTGG - Intergenic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942819068 2:180089658-180089680 CACAAAGAGGCGTTGGAGTCAGG - Intergenic
943311132 2:186326119-186326141 GAGAAAGAGGAGCAGGAGAAAGG - Intergenic
943864910 2:192917010-192917032 CAGAAAGAGGATGACCAGACTGG + Intergenic
944160460 2:196654004-196654026 GAGAAAGAGGAGGAGATGCCAGG + Intronic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944524456 2:200604246-200604268 AAGGAAGAGGAGGAGGAATGGGG + Intronic
945085704 2:206129951-206129973 AAAAAAAAGGAGGAGGAGTGGGG + Intronic
945889024 2:215408920-215408942 AAGAAGGAGGAGGAGGAGAAAGG - Intronic
945987531 2:216367312-216367334 GAGAAGGAGGAGGAGGAGGGAGG - Intronic
946025450 2:216669255-216669277 CAGGAGGAGGAGGAGGAATGGGG + Intergenic
946148554 2:217748927-217748949 CAGGAAGAGGAGGAGGCAGCAGG - Intronic
946330096 2:219004135-219004157 GAGACAGAAGAGGAGGAGTTGGG - Exonic
946885269 2:224216618-224216640 AATAAAGAAGAGGAAGAGTCTGG - Intergenic
947951997 2:234156205-234156227 AAGAAAGAGGAGGGGGAGGAGGG - Intergenic
948002197 2:234577445-234577467 GAGACAGAGGAGGAGGTGCCAGG + Intergenic
948035031 2:234851587-234851609 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
948049102 2:234966080-234966102 GAGAAAGAGGAGAAAGAGGCTGG + Intronic
948583224 2:239002450-239002472 CAGGGAGAGAAGGAGGAGTGTGG - Intergenic
948705841 2:239792047-239792069 GAAACAGAGGAGGAGGAGTGAGG + Intronic
948939224 2:241187826-241187848 GAGGAGGAGGAGGAGGAGTTGGG + Intergenic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1168974428 20:1953393-1953415 CAGAAAGAGGAGAATGAATGGGG - Intergenic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169215124 20:3789100-3789122 CAGAAAGAGGTGGGGAAGCCCGG - Intronic
1169557232 20:6764145-6764167 GAGAAAGAGGAGGAGAAGAAAGG + Intergenic
1169758490 20:9067827-9067849 GAGAAGGAGGAGGCGGAGTGGGG + Intergenic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170306349 20:14942419-14942441 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170495118 20:16916296-16916318 CAGAAGGGGGAGGAGGTGTCAGG + Intergenic
1170554506 20:17504634-17504656 CAGAAACTGCAGGAGGGGTCAGG + Intronic
1170556716 20:17520718-17520740 GGGAAGGAAGAGGAGGAGTCTGG - Intronic
1170579250 20:17685295-17685317 GAGAAAGAGAAGGAGGAGAGGGG + Intergenic
1170841127 20:19925033-19925055 CACAAAGAGGTGGGGGAGGCCGG - Intronic
1170929056 20:20752240-20752262 CAGAATGGGGAGGAGGAAACAGG + Intergenic
1170939877 20:20839938-20839960 TAGACAGAGGAGGAGGTGCCAGG - Intergenic
1170986447 20:21263702-21263724 GAGGAAGAGGAGGAGGAGAAAGG + Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171263292 20:23751006-23751028 AAGAAAGAGGAGGAGGAGTCAGG - Intronic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171367312 20:24634047-24634069 CAGAAGGAGGAGGAAGAGAATGG + Intronic
1171463368 20:25311289-25311311 GAGAAAAAGGGAGAGGAGTCAGG + Intronic
1171977929 20:31607113-31607135 CAGAGTGAGGAGGCCGAGTCTGG - Intergenic
1172031551 20:31985433-31985455 CAGGGAGAGGAGGAGCAGGCAGG + Intronic
1172043023 20:32059349-32059371 GAGGAAGAGGAGGAGGAGAAGGG - Intronic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172044494 20:32070886-32070908 AAGAAAGAGGAGGAGGAGGGAGG + Intronic
1172231213 20:33337517-33337539 GAGGAAGAGGAGGAGGAGCGAGG + Intergenic
1172299070 20:33835851-33835873 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1172437327 20:34938621-34938643 CAAAAAGAGGCGGAGGAGGAAGG + Intronic
1172442609 20:34976741-34976763 CAGAAAGAGGATGGGGAGGGAGG + Intronic
1172560565 20:35884348-35884370 CAGCAGGAGGAGGAGGAGCTGGG + Intronic
1172928628 20:38564866-38564888 GAGGAAGAGGAGGAGGAGGGAGG - Intronic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173111960 20:40199424-40199446 CAGAAATATAAGGAGGAGACAGG - Intergenic
1173443158 20:43095798-43095820 GAGAAAGAGGGGGAGGAGAGAGG - Intronic
1173858290 20:46265307-46265329 GAGAAAGAGGAGGAGGAAGAGGG - Intronic
1174150372 20:48482152-48482174 GAGGAAGAGGAGGAGGAGCAGGG + Intergenic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174641773 20:52050479-52050501 GAGAAAGAGGAGGAGGAAGGAGG - Intergenic
1174720644 20:52808427-52808449 GAGAAAGAGGAGGAGGAAGAGGG - Intergenic
1174730314 20:52909667-52909689 AAGAAAGAGGAGGAAGAGAGAGG - Intergenic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175660092 20:60804851-60804873 CAGAAAGAAGAGGTGCAGCCTGG - Intergenic
1175697129 20:61111031-61111053 CAAGAAGAGGAGGAAGACTCGGG - Intergenic
1175748042 20:61475413-61475435 GAGAAAGTGGTGGAGGAGGCTGG - Intronic
1176028567 20:62999051-62999073 TTGAAGGAGGAGGAGGAGTGGGG + Intergenic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176985565 21:15431863-15431885 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177177129 21:17712305-17712327 AAGGAAGAGGAGGAGGAGAAGGG - Intergenic
1177333013 21:19685123-19685145 GACAAGGAGGAGGAGGAGGCAGG - Intergenic
1177483505 21:21724630-21724652 GAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1177759834 21:25390938-25390960 TAGAATGAAGAGGAGGAGACTGG - Intergenic
1177833918 21:26170094-26170116 GGGGAGGAGGAGGAGGAGTCGGG - Intronic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1178397119 21:32252417-32252439 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1178411204 21:32365068-32365090 CTGTGAGAGGAGGAGGAGACAGG + Intronic
1178513939 21:33230330-33230352 CAGGAGGAGGAGGAGGAGTCGGG - Intronic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178982134 21:37273547-37273569 GAGAAAGAGGAGGATGAGGAGGG + Intergenic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179370654 21:40803548-40803570 ACGAAAGAGAAGGGGGAGTCTGG - Intronic
1179420516 21:41232632-41232654 GAGAGAGAGGAGGAGGTGCCTGG - Intronic
1179586521 21:42376952-42376974 TCCAAAGAGGAGGAGGAGTAGGG + Intronic
1179590285 21:42403603-42403625 AAGGAAGCGGAGGAGAAGTCAGG - Intergenic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1180020826 21:45125493-45125515 CAGAAATAGGAGGTGGAATCTGG + Intronic
1180112961 21:45673510-45673532 CAGAGAGAGAGGGATGAGTCTGG - Intronic
1180128799 21:45811379-45811401 CAGCAGGTGGAGGAGGACTCAGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1180647192 22:17348906-17348928 CATGAAGAAAAGGAGGAGTCAGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1180983881 22:19892712-19892734 CAGACAGAGGAGGAGGGCTAGGG + Intronic
1181264869 22:21625115-21625137 CAGAGAGAGAAGGAAGAGCCAGG - Intergenic
1181327496 22:22061087-22061109 GACAATGAGGAGGAGGAGTGGGG - Intergenic
1181338786 22:22162209-22162231 AGGGAAGAGGAGGAGGAGTGGGG - Intergenic
1181450668 22:23017909-23017931 CAGAAAAAGGACGAGGCGTGTGG + Intergenic
1181599577 22:23941557-23941579 CAGCAAGAGGAGGAGGTATCTGG - Intergenic
1181608930 22:23999749-23999771 CAGCAAGAGGAGGAGGTATCTGG + Intergenic
1181647667 22:24242606-24242628 CAGAAAAAAGAGCAGGAGACTGG + Intronic
1181735713 22:24879918-24879940 CAGAAAGAGCAGAAAGAGTAAGG + Intronic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182724864 22:32436389-32436411 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1182835537 22:33338461-33338483 AAGAAATAGGAGGAGGAGGTAGG - Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1182931478 22:34178308-34178330 GAGAAGGAGGAGGAGGAGGGAGG - Intergenic
1183174458 22:36212633-36212655 CAGGCAGAGGGGGAGGAATCTGG - Intergenic
1183184137 22:36282210-36282232 CAAAGAAAGGAGGAGGAGTGGGG + Exonic
1183255728 22:36760645-36760667 TAGAAACAGGACTAGGAGTCAGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183346736 22:37312271-37312293 CAGAAACAGGAGGGAGAGACTGG - Intronic
1183385432 22:37511457-37511479 GAGAAGGAGAAGGAGGAGGCGGG + Intronic
1183454134 22:37912289-37912311 CAGGAAGAGGAGGAGGCGTTAGG - Intronic
1183680956 22:39328901-39328923 CAGAAAAATGATGAGGAGACAGG - Intergenic
1183775461 22:39961288-39961310 GAGAAAGAGGAGCGGGAGACAGG + Intronic
1184029423 22:41883095-41883117 CAGATAGAGGATGGGGAGTCAGG + Intronic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184449735 22:44575846-44575868 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449765 22:44575980-44576002 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184502742 22:44883586-44883608 CAGGAGGAGGAGGAAGAGTGTGG - Intronic
1184525264 22:45019052-45019074 GAGGAAGAGGAGGAGGAGGGAGG + Intergenic
1184893683 22:47394611-47394633 CAGACAGAGGAGGAGAAGACAGG + Intergenic
1184933686 22:47702133-47702155 GAAGAAGAGGAGGAGGAGTGAGG - Intergenic
1185055297 22:48575955-48575977 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1185097158 22:48816554-48816576 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949094318 3:67739-67761 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949538610 3:5014795-5014817 GAGAAAGAGGAGGAGGACAAAGG + Intergenic
949587683 3:5458408-5458430 AAGAGGGAGGAGGAGGAGTGGGG - Intergenic
949644992 3:6083326-6083348 CAGGCAGAGGAGGAGGGGTGTGG - Intergenic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950280268 3:11701252-11701274 AAGAAAGAGGAAGAGGTGCCAGG - Intronic
950473394 3:13200410-13200432 CAGAAAGAGAAACATGAGTCTGG - Intergenic
950665940 3:14494997-14495019 CAGAAGGAGGAGGAGGTTCCTGG + Intronic
950727238 3:14924341-14924363 AAGAAAGAGGAGGAGGGGAGAGG - Intronic
950899629 3:16486085-16486107 CAGAAAGCAGAGGAGGAGGTGGG - Intronic
951081120 3:18451044-18451066 CAGAAAGAGGAGGGAGAGAGGGG + Intergenic
951556546 3:23926415-23926437 GAGCAAGAGGAGGAGGAGGAAGG - Intronic
951661313 3:25069697-25069719 CTGAAAGCGGAGGGGGAGGCAGG + Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952210742 3:31226765-31226787 CAGCAAGAGAAGGAGCAGGCAGG + Intergenic
952974938 3:38685773-38685795 AAGAGAGGGGAGGAGGTGTCAGG - Intergenic
953230240 3:41058300-41058322 AAGAAGGAGGAGGAGGAGGGAGG + Intergenic
953350280 3:42210102-42210124 GAGGAGGAGGAGGAGGGGTCTGG + Intronic
953682506 3:45050537-45050559 AAGAGAGAGGAGGAGGTGCCAGG - Intergenic
953850163 3:46459897-46459919 CCGAGAGAGAGGGAGGAGTCTGG - Intronic
954297027 3:49679958-49679980 CAGAGCGAGAAGGATGAGTCTGG - Intronic
954440297 3:50518100-50518122 CAGAATGAGGAGGTGGGGTGTGG + Intergenic
954501915 3:51025526-51025548 CAGAAAGACGGGGAGGGGTGCGG - Intronic
955078890 3:55639483-55639505 GACAAAGAGGAAGAAGAGTCTGG + Intronic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955092682 3:55768045-55768067 CAGAAAAAGGAGGAAGAGAGTGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
955307425 3:57848322-57848344 AAGAAACAGGAGGAGGAGAAGGG - Intronic
955347659 3:58173108-58173130 GAGACAGAGGAGGAGGAGGTGGG - Intergenic
955533292 3:59897371-59897393 CAGGAAGAGGAAGGGGATTCTGG - Intronic
955599960 3:60634699-60634721 GAGAAAGAGGAGAAGAAGTTTGG + Intronic
955996985 3:64687894-64687916 CAGGAGGAGGAGGAGGACTGGGG + Exonic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956681381 3:71785011-71785033 CAGCAAGAGGAGCAGGAGTGGGG + Exonic
957616774 3:82539176-82539198 GAGAGAGAGGAGGAGGGGTCAGG - Intergenic
957661101 3:83154913-83154935 AAGAAAGAGGAGGAGGTTCCAGG + Intergenic
957761841 3:84569033-84569055 CACAGAGGGGAGGAGGAGACAGG - Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958793393 3:98680017-98680039 AAGAAAGGGGAGGAGGAGAAGGG - Intergenic
959029316 3:101279536-101279558 CAGAAAGAGGAAGGGGAACCTGG + Intronic
959114615 3:102161963-102161985 AAGAAATAAGAGGAGGAGGCAGG + Intronic
959166965 3:102792512-102792534 AAGAAAAAGAAGGAGGAGTGAGG + Intergenic
959744359 3:109759408-109759430 GAGAAGGAGGAGGAGGAGACGGG - Intergenic
959972818 3:112426404-112426426 AAGAAAGAGGAGGAGGTGCCAGG + Intergenic
960350374 3:116585715-116585737 AAGGAAGAGGAGGAGGAGGCTGG + Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960831477 3:121854017-121854039 AAGAAAGAAGATGAGGAGGCTGG + Intronic
961030572 3:123599990-123600012 AAGAAGGAGGAGGAAGAGTGGGG - Intergenic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961476115 3:127147391-127147413 GAGGAAGAAGAGGAGGAGACGGG + Intergenic
961569400 3:127787122-127787144 CTGCATGAGGAGGAGGATTCAGG + Intronic
961621409 3:128227664-128227686 ATGATAGGGGAGGAGGAGTCTGG + Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961866655 3:129958360-129958382 AAGAAAGAGGGAGAGGAGACTGG + Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962200157 3:133394410-133394432 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962632060 3:137287828-137287850 CAGAAAGAGGGCGAGAGGTCAGG - Intergenic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962924790 3:139981916-139981938 CAGCAAGAGAGGGAGGGGTCAGG - Intronic
963511980 3:146257759-146257781 CAGAAAGATGAGGGGAAGTTTGG - Intergenic
963591149 3:147261310-147261332 ATGAAAGAGGAGGAGGAGACTGG - Intergenic
963836828 3:150066690-150066712 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
964101188 3:152990262-152990284 CTGAAAGAGGAGGAGAACTGAGG + Intergenic
964374400 3:156035405-156035427 AAGAAGGAGGAGGAGGAGGGAGG - Intergenic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964452676 3:156826639-156826661 CCGGAAGAGGAGGAGGAGGAGGG - Exonic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964791694 3:160459307-160459329 GAGGAAGTGGAAGAGGAGTCAGG - Intronic
965927744 3:174003036-174003058 CAGAAAGTTGAGGATGAGTGAGG + Intronic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
967682057 3:192375674-192375696 CACAAAGAGGGGGTTGAGTCTGG - Intronic
967784048 3:193470772-193470794 CAGGTAGAGGAGGAGGCGTAGGG + Intronic
967986691 3:195100563-195100585 GGGAGAGAGGAGGAGGAGGCTGG - Intronic
968007798 3:195254917-195254939 CAGAAAGATGAGGTAGAGCCAGG + Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968320554 3:197764411-197764433 TAGAAAGCAGAGGAGGAGGCGGG + Intronic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969344167 4:6560926-6560948 CACAAAGAGGAGGAAGGGTGGGG - Intronic
969543501 4:7808814-7808836 GAGAAAGAGGAGCAGGTGCCAGG - Intronic
969573364 4:8022990-8023012 GAGGAAGAGGAGGAGGAGAAAGG - Intronic
970491121 4:16574719-16574741 CAGAAAGTACAGGAGGAGACTGG + Intronic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970536216 4:17032042-17032064 TAGAAAGAGGAGCAGGTTTCTGG - Intergenic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
971123887 4:23731463-23731485 CAGAAATATGAGGAGCATTCTGG + Intergenic
971143940 4:23956214-23956236 AAGTGAGAGGAGCAGGAGTCTGG - Intergenic
971895894 4:32593536-32593558 GAGAAAGAGGAAGAGGTGCCAGG - Intergenic
972020725 4:34310327-34310349 AAGAGAGAGGAGGAAGTGTCAGG - Intergenic
972037176 4:34539618-34539640 CACAAAGAGAAGGAGGAGGTGGG - Intergenic
972407911 4:38764052-38764074 CAGAAAGAGGTTGAGGGCTCAGG + Intergenic
972850437 4:43042542-43042564 GAGAGACAGGAGGAGGAGCCAGG - Intergenic
973616725 4:52686217-52686239 GAGAAAGAGGAGGAAGAGGAAGG - Intergenic
973696818 4:53498312-53498334 GAGAAAGAGGAGGTGGAGAAAGG + Intronic
973758898 4:54099916-54099938 GAGAAAGAGGGGGAGGAGGCCGG + Intronic
973766521 4:54168178-54168200 CAGAAAGATGAGGAAGAGCCAGG + Intronic
973779766 4:54277330-54277352 CAGAAAGCTGAGGAGGCGTCTGG + Intronic
973894256 4:55396230-55396252 CAGAAAGAGCAGAAGCAGCCGGG - Exonic
974304474 4:60115864-60115886 AAGATAGAGGCGGAAGAGTCAGG - Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974760535 4:66267833-66267855 CAAAAAGAAGAGGAGGAGAATGG + Intergenic
975302306 4:72804764-72804786 CTGAAAGATGAGAAGAAGTCAGG + Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975483249 4:74905393-74905415 CAGAAGGAAGAGGAGGAATGGGG + Intergenic
975619723 4:76284111-76284133 AAGAGAGAGGAGGAGGAGCCAGG - Intronic
975628934 4:76380243-76380265 CAGAAAGACGAGGGAAAGTCTGG + Intronic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
977066932 4:92329965-92329987 GAGAAAAAGGAAGAGGAGTATGG + Intronic
977221732 4:94345412-94345434 CAGAAAGAGAAGTAGCTGTCAGG + Intergenic
977232067 4:94463546-94463568 GAGAAAGAGGAGGAAGAGGAAGG + Intronic
977289862 4:95153351-95153373 GTGGAACAGGAGGAGGAGTCAGG - Intronic
977349116 4:95857737-95857759 AAGAAAGAGGAGCAAGAGACAGG + Intergenic
977499601 4:97822382-97822404 CAGAAAGATGAGGAAAAGTTTGG - Intronic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
977983543 4:103355146-103355168 AAGAAAGAGGAGGAAGAGGAGGG + Intergenic
978014896 4:103731488-103731510 CATAGAGAGGAGGAGGAGATTGG - Intergenic
978134918 4:105245651-105245673 CAGAAAGAGCAAGAGGAGTCAGG - Intronic
978193078 4:105938613-105938635 GAGAAATAGGAGGAGGCCTCAGG + Intronic
978206740 4:106089203-106089225 GAGAGAGAGGAGGTGGAGCCAGG + Intronic
978295034 4:107195191-107195213 GAGAAAGCGGAGGGGGACTCAGG + Intronic
978777073 4:112515339-112515361 GAAGAAGAGGAGGAGGAGCCGGG - Exonic
978828172 4:113049618-113049640 CAGGAGGAGGAGGAGGGGTGGGG - Intronic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979356014 4:119706564-119706586 CAGAAAGTGAAGGAGGAGCAAGG - Intergenic
979559559 4:122086961-122086983 GAGAAACAGGAGGAGGAGAAAGG + Intergenic
979692471 4:123574465-123574487 CAGAAAGACGCAGAGGAGTGTGG - Intergenic
979903522 4:126254486-126254508 AAGAAAGAAGAGGAGGAATGTGG - Intergenic
980235749 4:130103767-130103789 CCCAAAGAGCAGGAGGAGCCTGG + Intergenic
980859857 4:138486242-138486264 AGGAAAGAGGAGTAGGAGTTGGG - Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
980969591 4:139556245-139556267 GAGGAAGAGGAGGAGCAGTCGGG + Exonic
980981424 4:139657576-139657598 GAGGAAGAGGAGGAGGAGAAGGG + Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981616977 4:146652639-146652661 AAGAAAGAAGAGGAGGAGAACGG - Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
981839676 4:149096398-149096420 CAAAGAGAAGAGGAGGAGTCTGG - Intergenic
981906362 4:149925700-149925722 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
982216530 4:153087220-153087242 CAGAGAGAGGCGGAAGAGTCAGG + Intergenic
982592770 4:157336192-157336214 CATAAAGAGGAGGGGCATTCGGG + Intronic
982711296 4:158760954-158760976 CAAAAAGAGAAGGGGGAGTGGGG - Intergenic
983039715 4:162911000-162911022 GAGGAAGAGGAGGAGGAGTAGGG - Intergenic
983275006 4:165606140-165606162 CAGAAAGAGGAGGTGGAAGGAGG - Intergenic
983314348 4:166109693-166109715 GAGAAAGAGAAGGAGGAGATTGG - Intergenic
983317532 4:166151153-166151175 AAGAAAGAGGAAGAGGAGAGTGG + Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
984912621 4:184688561-184688583 CAGAAAGAGCAGGAAGGGCCAGG - Intronic
985909221 5:2865967-2865989 AAGAAAGAAGAGGAGGAGAGTGG + Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
986221740 5:5774798-5774820 GAGAAAGGGGAGGAGGAGTGGGG - Intergenic
986399605 5:7368210-7368232 GAGAGAGAGGAGGAGGTATCGGG - Intergenic
986453428 5:7890236-7890258 AAGAAAAAGGAGGAGAAATCAGG - Intronic
986700621 5:10404732-10404754 GAGGAAGAGGAGGAGGGGTCAGG + Intronic
986853996 5:11847476-11847498 GGGAAGGAGGAGGAGGAGGCAGG + Intronic
987062366 5:14254641-14254663 AAGAAACAGGAGGAGGAGGGTGG - Intronic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987579915 5:19776457-19776479 AAGAAAGAGGAGGAAGAGGATGG + Intronic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988314753 5:29610394-29610416 GAGGAAGTGGAGGAGGAGTTGGG - Intergenic
988462814 5:31456507-31456529 CAGAGAGAGGAAGAGAAGTAAGG + Intronic
988567451 5:32330572-32330594 CAGACAGAGGTGCAGGACTCAGG + Intergenic
989539914 5:42606504-42606526 AAGAAAGAGGAGAAGGTGCCAGG + Intronic
990079747 5:51898867-51898889 GAGAAAGAGGAGGAAGAGGAGGG + Intergenic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
990397408 5:55396475-55396497 AAGGAAGAGGAGGAAGAGGCAGG + Intronic
990499918 5:56385779-56385801 AAGAAAGAGGAGGAGGAGAGAGG - Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
992457911 5:76933146-76933168 GAGAAAGAGGAAGGGGTGTCAGG + Intergenic
992751530 5:79867193-79867215 AAGAAAGAGGAGGGGGAGAGAGG - Intergenic
993160053 5:84278803-84278825 CAAAGAGAACAGGAGGAGTCAGG - Intronic
993505106 5:88699712-88699734 CAGGAAGAGGATGAGGAGAAAGG - Intergenic
994026630 5:95091618-95091640 CAAGAAGAGAGGGAGGAGTCTGG + Intronic
994309595 5:98252933-98252955 AAGAGAGAGGAGGAGGTGCCAGG + Intergenic
994784836 5:104144832-104144854 AAGGAAGAGGAGGAGGAGAAAGG - Intergenic
995205642 5:109476718-109476740 CAAAAAGAGTTGGAGGCGTCAGG + Intergenic
995466306 5:112452744-112452766 CAGAAAGAGGTGGAAGAGGAAGG - Intergenic
995466786 5:112458163-112458185 CAGAAAGAGAAGAAAGAGACAGG + Intergenic
995754344 5:115486680-115486702 CAAAAAGAGGAGGAGGACAGAGG - Intergenic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996631395 5:125637258-125637280 AAAAGAGAGGAGGAGGATTCTGG - Intergenic
997103465 5:130993782-130993804 CAGAAAGAGGCTGAGGTGTGTGG + Intergenic
997111156 5:131076078-131076100 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997304637 5:132828518-132828540 CAGAAAGAGTAGGAAGAGAAAGG - Intronic
997348529 5:133211733-133211755 CAGAATGAAGAGGAGAAGCCAGG - Intronic
997739095 5:136238093-136238115 GAAAAAGAGGAGGAGCAGCCAGG - Intronic
997897217 5:137729922-137729944 CTGAAAGAGGATGAAGAGTATGG - Intronic
997963036 5:138337402-138337424 CAGAAAGGGAAGGAGGAAACAGG - Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998266220 5:140669616-140669638 CAGGAAGAAAAGGAGGAGACTGG + Exonic
998590979 5:143477929-143477951 AGGAAAGAGGAGGATGAGTAGGG - Intergenic
998642274 5:144024599-144024621 CAAGATGAGGAGGAAGAGTCAGG + Intergenic
998707966 5:144786019-144786041 CATAAAGAGGAAAAGGAGTAAGG - Intergenic
998897321 5:146813824-146813846 CAGCAAGAGGAGGAGAATCCAGG + Intronic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
998991582 5:147823220-147823242 AAGAGAGAGGAGGAGGAGGAGGG - Intergenic
999001243 5:147925226-147925248 GAGGGAGAGGAGGAGGAGCCAGG + Intergenic
999135014 5:149312828-149312850 GAGAAAGAGAAGGAGTAGGCCGG + Intronic
999154071 5:149445618-149445640 AAGAAGGAGGAGAAGGAGTGGGG + Intergenic
999512910 5:152271411-152271433 CAAAACGAGCAGGAAGAGTCCGG + Intergenic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000265427 5:159631775-159631797 GAGAAAGGGGAGGAGGTGCCTGG + Intergenic
1000295314 5:159908491-159908513 AAGAAAGAGGAGGACGTGCCAGG - Intergenic
1000329857 5:160197990-160198012 GAGAAAGAGGAGCAGGAGGTGGG + Intronic
1000594740 5:163201979-163202001 GAGAGAGAGGAGGAGAAGCCAGG - Intergenic
1000963663 5:167629880-167629902 GAGAAGGAGGAGGAGGAGGGGGG + Intronic
1001124956 5:169011034-169011056 CAGAAAGAAGAGCAGGGCTCAGG + Intronic
1001179420 5:169505297-169505319 CAGATAGAGGAGGAGGTTACTGG + Intergenic
1001233575 5:170010457-170010479 CAGGAAGATGAGAAGGAGTAAGG + Intronic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001334260 5:170784464-170784486 CAGGAAGAGGCGGGGGAGACTGG + Intronic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001821358 5:174712941-174712963 GAGAAAGAGGAGGTGGTTTCTGG - Intergenic
1001928279 5:175655234-175655256 CGGAAAGAGGATGATGTGTCTGG - Intergenic
1002136739 5:177112465-177112487 CCGAAAGAGGAGGAGGAGTTTGG - Intergenic
1002187155 5:177459677-177459699 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1002446302 5:179292189-179292211 CAGAGAGAAGCGGCGGAGTCAGG + Intronic
1002743887 5:181455356-181455378 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1002795709 6:469697-469719 CAGAGAGAGGAGGGGGAGAGAGG - Intergenic
1003066640 6:2909414-2909436 CTGAGAGAGGAGGATGTGTCAGG - Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003139250 6:3457087-3457109 GAGGAGGAGGAGGAGGAGTGGGG - Intergenic
1003143632 6:3491965-3491987 GAGAAAGAGAAAGAGGAGTTTGG - Intergenic
1003227083 6:4215725-4215747 AAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1003280006 6:4683004-4683026 CAGAAAGTGAAGGAGGAGCAAGG - Intergenic
1003287404 6:4746582-4746604 CTGAGAGAGGAGGCGGGGTCAGG + Intronic
1003457076 6:6293024-6293046 CAGAAAGATGAGGAGAAGGATGG - Intronic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004278499 6:14258885-14258907 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1004955364 6:20722924-20722946 CAGAAAGTGGAGGTGGAGAGGGG - Intronic
1005775902 6:29130430-29130452 CAGAAAGTGGAGGGTGAGTTAGG - Intergenic
1005824896 6:29626924-29626946 TAGAAGGATGAGAAGGAGTCAGG + Intronic
1006180638 6:32151652-32151674 CAGAAAGAGGAGGGGGACTGGGG + Intronic
1006371970 6:33650414-33650436 AAGAAAGATACGGAGGAGTCAGG + Intronic
1006437807 6:34035299-34035321 GAGAAAGAGGAGGAGGGGGAAGG + Intronic
1006440442 6:34050465-34050487 GAAAGAGAGGAGGAGGAGCCAGG - Intronic
1006547707 6:34792876-34792898 CAGACAGAAGAGGAGGAGGTGGG - Intronic
1006609743 6:35287147-35287169 CAGAATGAGCAGGAGGAAACTGG + Intronic
1006621920 6:35371296-35371318 CGGAAAGAGGAAGAGGAACCAGG - Intronic
1006731614 6:36240280-36240302 CAGAAAGAGGAGGACTGGCCAGG - Intergenic
1006896935 6:37477302-37477324 GAGAAAGAGGAAGAAAAGTCTGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007235930 6:40391566-40391588 GTGAATGAAGAGGAGGAGTCTGG + Exonic
1007395631 6:41576057-41576079 CGGAAAGAGGAGGAAGGGTGGGG - Intronic
1007427254 6:41755603-41755625 AAGAAGGAGGAGGAGGAGAAGGG + Intergenic
1007581465 6:42962731-42962753 CAGGAAGAGAAAGAGGAATCAGG - Intronic
1007591804 6:43025947-43025969 AAGAAAGATGAGGAAGAGACAGG + Intronic
1008508602 6:52255374-52255396 CAGACAGAGGAAGAGCAGGCAGG - Intergenic
1009697671 6:67130222-67130244 AAGAAAGAGGAGGAGAAGAAAGG - Intergenic
1009965642 6:70574989-70575011 CAGAAAGCGCAGGAGAAGCCAGG - Intronic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011534522 6:88361804-88361826 CAGAAAGAGCACGTGGAGACTGG + Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012399125 6:98830460-98830482 TAAAAAGAGGAGGAGGAGTAGGG + Intergenic
1012973863 6:105758777-105758799 GAGAAAGATGAGGAGGACTGGGG - Intergenic
1012985113 6:105867365-105867387 CTGAAGGAGGAATAGGAGTCTGG + Intergenic
1013484740 6:110585922-110585944 AAGAGAGAGGAGGAGGCGCCAGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014055003 6:117003326-117003348 CAGAAATTGGAGGTGGAGTAGGG - Intergenic
1014207584 6:118672893-118672915 GAGAAAGAAGAGGAGGAGGGAGG + Intronic
1014261678 6:119225434-119225456 AAGGAAGAGGAGGAGGAGAAAGG + Intronic
1014318329 6:119894464-119894486 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014808343 6:125857202-125857224 CAAAAAGAGGAAGAGGATTAAGG + Intronic
1014843948 6:126252883-126252905 CAGGAAGTAGAGGAGGAGACAGG + Intergenic
1014871709 6:126604014-126604036 TAGACAGAGGAGGAGGAGGCAGG - Intergenic
1015373347 6:132481007-132481029 CTGAAAGAGGAGGAGCACACAGG + Intronic
1015404460 6:132821502-132821524 AAGAAAGAGGAGGAGGAAAAGGG - Intergenic
1015489872 6:133812842-133812864 GAGAGAGAGGAGGAGGTGCCAGG + Intergenic
1015625955 6:135181323-135181345 GAGAAGGAGGAGGAGGAAACAGG - Exonic
1015702950 6:136056087-136056109 TAGAAGGAGGAGGAGGAATCTGG + Intronic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016012444 6:139151985-139152007 CAGAAAGAGTATGTGGAATCTGG + Intronic
1016324499 6:142884670-142884692 GAGAAAGAAAAGGAGGAGTTAGG + Intronic
1016373169 6:143394824-143394846 AAAGAAGAGGAGGAGGAGTTGGG + Intergenic
1016390610 6:143570837-143570859 TTGGAAGAAGAGGAGGAGTCCGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017034253 6:150252711-150252733 CAGAGAGGGGAGGAGGTGCCAGG - Intergenic
1017068248 6:150549660-150549682 GAGGAACAGGAGGAGGACTCGGG - Intergenic
1017184022 6:151582755-151582777 GAGAGAGAGGAGGAGGTGCCAGG + Intronic
1017297211 6:152811949-152811971 GAGAAAGAAGAGGAGGAGAAAGG - Intergenic
1017339640 6:153305453-153305475 AAGAAGAAGGAGGAGGAGTAGGG - Intergenic
1017437443 6:154429713-154429735 GAGAAGGAGGAGGAGGAGACGGG - Intronic
1017462964 6:154668401-154668423 AAGAAAGAGGAGGAGGAAGGAGG + Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017978270 6:159376331-159376353 TAGAAAGATGAAGAGGAGGCAGG + Intergenic
1018038028 6:159898485-159898507 GAGGAGGAGGAGGAGGAGTCTGG - Intergenic
1018405095 6:163472341-163472363 GAGGAAGAGGAGGAAGATTCAGG + Intronic
1018911486 6:168102843-168102865 CAGAAGGAAGAGGAGGAGAAGGG - Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019093860 6:169563226-169563248 AGGAAAGAGGTGGAGGAGGCTGG - Intronic
1019248746 6:170728585-170728607 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1019254519 7:40784-40806 CAGGAGGCGGGGGAGGAGTCAGG - Intergenic
1019419071 7:942360-942382 AAGAGAGAGGAGGAGGAGGAAGG + Intronic
1019551837 7:1606927-1606949 CACGAAGAGGAGGAGGAGGAGGG - Intergenic
1019551878 7:1607077-1607099 AGGAAAGAGGAGGGAGAGTCTGG - Intergenic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019570885 7:1711502-1711524 CAGAAAGAGGAGGAGACAGCCGG + Intronic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019727990 7:2613486-2613508 GAGAAAGAGGAGGAGGCCCCAGG + Exonic
1019838753 7:3417332-3417354 CAGAAAGAAGACGAAGAGTCGGG - Intronic
1019907455 7:4075425-4075447 CAGAATGAGGAGGAAGTTTCAGG + Intronic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1020921814 7:14274752-14274774 CAGAAAGAGGGAGAGGGCTCTGG + Intronic
1021690203 7:23223599-23223621 CAGACAGAGGAGGAGGTGAAGGG - Intergenic
1021844247 7:24748665-24748687 AAGAAAGAGAAGGAGGAGTGGGG - Intronic
1022540835 7:31134339-31134361 AAGAAAGAGGCCTAGGAGTCTGG + Intergenic
1022547758 7:31204564-31204586 CAGAAAGAGCAGGAAGAGTGTGG - Intergenic
1022578097 7:31518084-31518106 AAGAAAGAGGCAGAAGAGTCAGG + Intronic
1022597154 7:31723584-31723606 CTGGGAGAGGAGGCGGAGTCAGG + Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023042238 7:36181850-36181872 AACAAAGAGGAGGAGGAGAGAGG + Intronic
1023488847 7:40715670-40715692 TAGGAAGAGGAGGTGGAATCCGG - Intronic
1023902022 7:44488980-44489002 CAGAAAGATGTGGAGGAGAAAGG - Intronic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024286702 7:47763920-47763942 CAGAAAGAGATGGAGGCATCAGG + Intronic
1025100515 7:56130998-56131020 CAGAAAGAGAAAGAGAAGACAGG - Intergenic
1025114655 7:56247410-56247432 GTGAAGGAGAAGGAGGAGTCAGG - Intergenic
1025147858 7:56520515-56520537 CAGAAAGAGAAAGAGAAGACAGG - Intergenic
1025234409 7:57224248-57224270 GAGAAGGAGGAGGATGTGTCAGG - Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025602227 7:63011776-63011798 TATGAAGAGGAGGAAGAGTCAGG + Intergenic
1025626132 7:63224101-63224123 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1026043317 7:66886994-66887016 CGGAGAGAGGAGGAGGTGCCAGG + Intergenic
1026318539 7:69248803-69248825 CAGAAAGAGAAAGAGAAGACAGG + Intergenic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026679033 7:72451378-72451400 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1026899314 7:74028219-74028241 CAGCAGGAGCAGGAGGACTCCGG - Exonic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027043536 7:74976527-74976549 GAGGAGGAGGAGGAGGAGACAGG - Intronic
1027080110 7:75225832-75225854 GAGGAGGAGGAGGAGGAGACAGG + Intergenic
1027424885 7:78052340-78052362 AAGAAAGAGGAGGGGGTGCCAGG - Intronic
1027677679 7:81180206-81180228 CAGGAAGATGAGGAAAAGTCTGG + Intronic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028404109 7:90457510-90457532 CACAAGGTGGAGGAGGTGTCAGG + Intronic
1028616394 7:92772641-92772663 AAGAAAGGGGAGGAGAAGACAGG - Intronic
1028937758 7:96485428-96485450 CAGAGTGAGTAGGAGGAGTTGGG - Intronic
1029042742 7:97594803-97594825 CAGAAAGAAGAGGAGGAGAAAGG - Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029230531 7:99064300-99064322 CAAAAAGACGAGGAGGAGGAGGG - Intronic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029623564 7:101705641-101705663 GAGAAAGAGGAAGAGGAGGTGGG + Intergenic
1029653972 7:101912241-101912263 GAGATAGAGGAGGAGGAGGGAGG - Intronic
1029745105 7:102512261-102512283 GAGAAGGAGGGGGAGGAGACAGG + Intronic
1029763097 7:102611422-102611444 GAGAAGGAGGGGGAGGAGACAGG + Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030035521 7:105405319-105405341 GAGAAGGAGGAGGGGGAGTAAGG + Intergenic
1030162840 7:106526012-106526034 CAGAAAGCAGAGGAGGAGTGAGG - Intergenic
1030317582 7:108132278-108132300 GAGAATGAGGAGGAGGGATCTGG - Intergenic
1030503317 7:110387141-110387163 CAGCAAGAGGTGGAGCAGCCTGG - Intergenic
1030835394 7:114277769-114277791 CAGAAAGAGGCGGAGGTGGATGG + Intronic
1030953956 7:115827403-115827425 GAGACAGAGGAGGAGGGTTCTGG + Intergenic
1030955328 7:115844820-115844842 CAGAAAGAATATGAGAAGTCTGG + Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1032073032 7:128821446-128821468 AAGAAAGAGGAGGGGAAATCTGG - Intronic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032466819 7:132151352-132151374 AAGAAGGAGGAGGAGGAGAAAGG + Intronic
1032504546 7:132425498-132425520 GAGGAAGGGGAGGAGGAGCCAGG - Intronic
1032523167 7:132561500-132561522 GAGAAGGAGGAGGAGGAGGTGGG - Intronic
1032523313 7:132562093-132562115 GAGAAGGAGGAGGAGGAGAAAGG - Intronic
1032523480 7:132562846-132562868 GAGAAGGAGGAGGAGGAGAAAGG - Intronic
1032523564 7:132563183-132563205 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1032575844 7:133053381-133053403 CAGAGAGAGGCAGAGGCGTCAGG - Intronic
1032854852 7:135825563-135825585 CACAAGGAGGAGGAGCAGACAGG + Intergenic
1033443455 7:141400493-141400515 AAGGAGGAGGAGGAGGAGACAGG - Intronic
1033454331 7:141488950-141488972 GAGAAAGAGAAGGAGGAGGGAGG + Intergenic
1033600637 7:142886029-142886051 GAGAAAGGAGGGGAGGAGTCAGG + Intergenic
1033657278 7:143382255-143382277 CAGCAAGGGGAGGTGGAGGCAGG - Exonic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034214837 7:149397535-149397557 AAGAGAGAGGAGGGGGAGCCTGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034255923 7:149724665-149724687 CAGGATGGGGAGGAGGGGTCAGG - Exonic
1034275844 7:149823532-149823554 AAGAAGGAGGAGCAGGAGTGTGG - Intergenic
1035038406 7:155910218-155910240 CAGGCAGAGGAGGAGGAGCAAGG - Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035499299 8:78750-78772 TGGAAAGAGGAGGAGGAGGACGG - Intronic
1035738309 8:1905497-1905519 GAAAAAGATGAGGAGAAGTCTGG - Intronic
1035793182 8:2326222-2326244 CAGGGAGAGGAGGTGGGGTCGGG + Intergenic
1035799622 8:2395483-2395505 CAGGGAGAGGAGGTGGGGTCGGG - Intergenic
1035945883 8:3962105-3962127 CAGAAAGAGGAGGAAGGTCCTGG - Intronic
1036450670 8:8864372-8864394 GGCAAAGAGGAGGAGGAGTCGGG - Intronic
1036507915 8:9372527-9372549 CAGACAGAGGAAGAGGGCTCGGG - Intergenic
1036601051 8:10260408-10260430 GAGACAGAGGAGGAGGAAGCGGG + Intronic
1036608917 8:10333189-10333211 CTGAAAGATGAGTAGGAGTGTGG - Intronic
1037218182 8:16483870-16483892 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037218195 8:16483930-16483952 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037699315 8:21259602-21259624 GAAAAAGAGGAGGAGGAGAAGGG + Intergenic
1037773740 8:21818941-21818963 GAGAAAGATGAGGAGGAGGAGGG - Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037934295 8:22904251-22904273 CTGGAAGAGGAGAAGGAGCCAGG + Intronic
1037946106 8:22990604-22990626 CAGAAGGAGGAGGAAGAGGGTGG + Intronic
1038063122 8:23934323-23934345 GAGAAAGAAAAGGAGGAGTCTGG + Intergenic
1038161364 8:25042162-25042184 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1038313410 8:26463141-26463163 GAGAAGGAGGAGGAGGAGAACGG - Intronic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038339542 8:26673923-26673945 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038522442 8:28244721-28244743 CAGGAAGAGGAGGAGGGGAGGGG + Intergenic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1039195654 8:35028504-35028526 CAGAAAGAGGAAAAGGAGCAGGG + Intergenic
1039317325 8:36387872-36387894 AAGAAGGAGGAGGAGGAGAAGGG - Intergenic
1040440758 8:47439225-47439247 GAGAAAGAGGAGTATGACTCAGG - Intronic
1040570240 8:48602144-48602166 AAGACAGAGAAGGAGGAGGCGGG - Intergenic
1040680275 8:49800877-49800899 CAGAAAGAGGAGTGGGAGAAAGG - Intergenic
1040861145 8:52000477-52000499 CAGGAAGAGGAGGCAGAGGCAGG + Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041669139 8:60475524-60475546 GAGAAAGAGGAGGAGAAAGCAGG - Intergenic
1041739731 8:61145513-61145535 AAACAAGAGGAGGAGGAGCCAGG + Intronic
1041746189 8:61211474-61211496 AAGGAAGAGGAGGAGGAGAGGGG - Intronic
1042032238 8:64489040-64489062 GAGAGAGAGGAGGAGGAGTCAGG + Intergenic
1042775029 8:72420565-72420587 CTGGAAGTGGAGGAGGAGTGGGG - Intergenic
1042861854 8:73322352-73322374 TAGAAAGAGGAGAAGGTGTTTGG - Intronic
1043192025 8:77237596-77237618 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1043829408 8:84970000-84970022 CAGAGAGAGGAAGAGAAGGCTGG + Intergenic
1043920704 8:85980246-85980268 GAGAGAGAGGAGGAGGGGCCAGG - Intergenic
1044090327 8:87992533-87992555 TAGGAAGAGGAGGAGGAGGGGGG - Intergenic
1044244429 8:89925501-89925523 TTGAAAGAGGAGGAGGAGATGGG + Exonic
1044831150 8:96250678-96250700 AAGAAGGAGGAGGAGGAGGGGGG + Intronic
1044897048 8:96903529-96903551 CATGAAGAGGAAGAGGAGACAGG - Intronic
1044953159 8:97452940-97452962 AAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1044995043 8:97830619-97830641 CAGAAGGAGGTAGAGGAGTTAGG + Intronic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045184511 8:99823449-99823471 GAGGAGGAGGAGGAGGAGTGAGG + Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1047058535 8:121195423-121195445 CAGAAATAAGTAGAGGAGTCAGG - Intergenic
1047340060 8:123972492-123972514 AAGGAAGAGGAGAAGGATTCTGG - Intronic
1047411851 8:124630402-124630424 CTGAAAGAGGAGGTGGAGAAAGG + Intronic
1047427269 8:124758190-124758212 CAGAAAGATCAAGAGGAGCCAGG + Intergenic
1047518696 8:125577831-125577853 TAGAAAAAGGAAGAGAAGTCTGG - Intergenic
1047541222 8:125768486-125768508 GAGAAGGAGGAGGAGGACCCAGG + Intergenic
1048170730 8:132103737-132103759 CAGAAAGGACAAGAGGAGTCTGG - Intronic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048267352 8:132999179-132999201 GAGAAGGACGAGCAGGAGTCTGG + Intronic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048956701 8:139543416-139543438 GAGCAAGTGGAGGAGGAGGCAGG + Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049037402 8:140087222-140087244 GAGACAGAGGAGGAAGAGCCAGG - Intronic
1049403689 8:142442375-142442397 CTGGGAGAGGAGGAGGAGGCAGG - Intergenic
1049444658 8:142624448-142624470 CAGAAAGAGGAGGAGTGGAGAGG + Intergenic
1049684118 8:143932455-143932477 GAGAAGGAGGAGGAGGAGGTGGG - Exonic
1049820367 8:144629763-144629785 CAGGAAGAGGAGGAGGGCGCTGG + Intergenic
1051078340 9:13266834-13266856 GAGAAAGAGAAGGAGGAGGAAGG + Intronic
1051150314 9:14072588-14072610 CAGAGAGGGAAGGAGGAGTGTGG + Intergenic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051296765 9:15604632-15604654 TAGAAAGAGGAGGAAGAGTAGGG + Intronic
1051444286 9:17124096-17124118 CAGCAAGAGGAGAAGAGGTCTGG + Intergenic
1052308271 9:27036190-27036212 GAGGAAGAGGAGGAAGAGTTTGG + Intronic
1053047216 9:34929827-34929849 AAAAAAGAGGATGAAGAGTCGGG - Intergenic
1055180311 9:73379270-73379292 AAGAGAGAGGAGGAGGTATCAGG - Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1056709346 9:88978096-88978118 AAGGAGGAGGAGGAGGAGACGGG - Intergenic
1057276418 9:93678122-93678144 CAGAAAGAGGAGGAGCAAGTGGG + Exonic
1057437983 9:95059588-95059610 CAGAAAGATGAGGAGCAGGGAGG + Intronic
1057497373 9:95571852-95571874 GAGAAGGAGGAGGAGGAGAGGGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057922009 9:99105234-99105256 CAGCACGAGGAGGAGCAGCCGGG - Exonic
1058186075 9:101856682-101856704 CAGAAAGAGGCCAAGGAATCGGG - Intergenic
1058575014 9:106391655-106391677 CAGAAAGAGGTGGGTGGGTCAGG + Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1058956141 9:109950502-109950524 CAGACAGAGGAGCAGGTGTAGGG - Intronic
1059021354 9:110579785-110579807 GAGAGAGAGGAGGAGGAGAGAGG - Exonic
1059072406 9:111152755-111152777 TAGTAAGAGGAGGAGGAGAAAGG + Intergenic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059450720 9:114370191-114370213 CTGAAAGAGGGGGAGGCGGCGGG - Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059788451 9:117612965-117612987 GAGAAAGAGGAGGAGAAGGGAGG + Intergenic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1060247578 9:121959175-121959197 CAAAAAGAGGAGTGAGAGTCAGG + Intronic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1060745444 9:126127904-126127926 CAGCAGGAGAAGGAGGAGTGAGG + Intergenic
1061360444 9:130138511-130138533 GAGAAAGAGGTGGAGGAGGGAGG - Exonic
1061380569 9:130254310-130254332 CAGAGAGAGGAAGAGAAGCCTGG - Intergenic
1061613637 9:131764783-131764805 GAGAAGGAGGAGGAGGAGAGAGG - Intergenic
1061690336 9:132322404-132322426 CAGAAAGATGAGTAGTAGTCAGG - Intronic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062417971 9:136462993-136463015 CAGGTGGAAGAGGAGGAGTCTGG - Exonic
1062745880 9:138211769-138211791 CAGGAGGCGGGGGAGGAGTCAGG + Intergenic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1203794525 EBV:169552-169574 CAGAATGAGGTGGCGGATTCAGG + Intergenic
1203609704 Un_KI270748v1:85849-85871 TGGAAAGAGGAGGAGGAGGACGG + Intergenic
1185499042 X:583931-583953 AAACAAGAGGAGGAGGAGGCTGG + Intergenic
1185499258 X:584794-584816 GAGAAAGAGGAAGAGGAGAGGGG + Intergenic
1185575471 X:1168957-1168979 GAGAAAGAGGAAGAGGAGGAGGG + Intergenic
1185662142 X:1736001-1736023 GAGAAAGCGGAGGAGGAGGAGGG - Intergenic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1186149332 X:6657594-6657616 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1186676689 X:11824652-11824674 CAGAAAGAGGAGGAGAAAATGGG + Intergenic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1187175749 X:16894990-16895012 AAGGAAGAGAAGGAGGAGTGGGG - Intergenic
1187241461 X:17517706-17517728 GAGAAAGAAGAGGAGGATTTAGG + Intronic
1187289560 X:17940050-17940072 GAGGGAGAGGAGGAGGTGTCAGG - Intergenic
1187825733 X:23332955-23332977 CAGGAAGAGGAAGGGGAGTGGGG - Intergenic
1187993825 X:24904543-24904565 AAGAAAGAGAAAGAGGATTCAGG - Intronic
1188419099 X:29974701-29974723 CAAAAAGAGAAGGAGGAGAGAGG - Intergenic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1188662448 X:32776249-32776271 CAGAAAGATGAGGGAGAGTTTGG - Intronic
1188993292 X:36850978-36851000 GAGAAGGAGGAGGAGGAGAAAGG - Intergenic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189326852 X:40117820-40117842 CAGAAAGAGGAGGAAGCCTCAGG - Intronic
1190123389 X:47682579-47682601 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1190291772 X:48997735-48997757 CAGGGAGAAGAGGAGGGGTCAGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192217925 X:69176995-69177017 GAGACAAAGGAGGAGGACTCTGG - Intergenic
1192331069 X:70175610-70175632 AAGAAAGAGGAGGAAGAGGAAGG + Intergenic
1192432679 X:71123062-71123084 AAGGAAGAGAAGGAGGAGTAAGG - Intronic
1192448076 X:71225044-71225066 AAGGAAAAGGAGGAGGTGTCTGG + Exonic
1193058631 X:77181195-77181217 CAGAAAGATGAGGAAAAGTTTGG + Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1194048119 X:89034485-89034507 CAGAAAGATGAGGATAAGTTTGG - Intergenic
1194363288 X:92981908-92981930 AAGATAGAGGAGCAGGGGTCAGG + Intergenic
1194467360 X:94250100-94250122 CAGAAAGAGGATGATAAGCCAGG - Intergenic
1194637607 X:96364552-96364574 GCGAAAGAGGAGGAGGAGAGAGG - Intergenic
1194825037 X:98551117-98551139 GAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1194992903 X:100564044-100564066 AAGAAGGAGGAGGAGGAGTGGGG + Intergenic
1194995405 X:100586707-100586729 CAGTAAGGGGAGGAGGAGTAGGG - Intronic
1195287929 X:103403709-103403731 CAGAAAGAGGAGTAGCACTGTGG + Intergenic
1195370201 X:104166252-104166274 GAGAAAGCGGAGGAGGAGGTTGG + Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195859901 X:109372474-109372496 AAGAAAGAGGGAGAAGAGTCTGG - Intergenic
1196237581 X:113300064-113300086 CAGAGAGAGGAGGAGGGGAAGGG - Intergenic
1196264874 X:113631140-113631162 CAAAAAGAGGAGGAGAAATGAGG + Intergenic
1196311446 X:114171418-114171440 AAGAAAGAGGAGGAGGAGAATGG - Intergenic
1197873958 X:131084718-131084740 AAGAAAGAGCAGGAGGAGGTGGG + Intronic
1198014979 X:132601379-132601401 CAGAAAGTGGAGGATGTCTCAGG - Intergenic
1198117242 X:133555980-133556002 ATGAAAAAGGAGGAGGAATCTGG - Intronic
1198302771 X:135347582-135347604 GAGAAAAAGGAAGAGGACTCTGG - Intronic
1198496467 X:137198201-137198223 CAGTAAGAGGAGGCGGACACAGG + Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199284644 X:146042498-146042520 TAGAAAGAGGAGGTGGGGGCCGG + Intergenic
1199347207 X:146755678-146755700 GAGAAGGAGAAGGAGGAGTTGGG + Intergenic
1199417307 X:147599952-147599974 CAGTAAGAGTAGCAGGAGGCTGG + Intergenic
1199715752 X:150506336-150506358 AAGGAAGAGGAGGAGGAGGAAGG - Intronic
1199863743 X:151824684-151824706 AAGGAAGAGGAGCAGGACTCAGG + Intergenic
1199932297 X:152535909-152535931 CAGGAAGATGAGGAGGAATCAGG + Intergenic
1200671529 Y:6098157-6098179 AAGATAGAGGAGCAGGGGTCAGG + Intergenic
1201264950 Y:12197158-12197180 CAGAAACAGGAGGATGAGAGAGG - Intergenic
1201300273 Y:12498833-12498855 CAGGAGGAGGAGGAGGAGAAGGG - Intergenic
1201632242 Y:16081474-16081496 CAGATGGAGAAGGAGGAGTGGGG - Intergenic
1201742945 Y:17343260-17343282 CAGGAAGAGAAGGAAGAGTCTGG + Intergenic