ID: 1171277695

View in Genome Browser
Species Human (GRCh38)
Location 20:23872336-23872358
Sequence GAGCCTCCTCACATTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171277684_1171277695 25 Left 1171277684 20:23872288-23872310 CCTAGCCAATGAGACTGCAGGGG No data
Right 1171277695 20:23872336-23872358 GAGCCTCCTCACATTCAGGAAGG No data
1171277687_1171277695 20 Left 1171277687 20:23872293-23872315 CCAATGAGACTGCAGGGGTGGTG No data
Right 1171277695 20:23872336-23872358 GAGCCTCCTCACATTCAGGAAGG No data
1171277680_1171277695 30 Left 1171277680 20:23872283-23872305 CCAGCCCTAGCCAATGAGACTGC No data
Right 1171277695 20:23872336-23872358 GAGCCTCCTCACATTCAGGAAGG No data
1171277682_1171277695 26 Left 1171277682 20:23872287-23872309 CCCTAGCCAATGAGACTGCAGGG No data
Right 1171277695 20:23872336-23872358 GAGCCTCCTCACATTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171277695 Original CRISPR GAGCCTCCTCACATTCAGGA AGG Intergenic
No off target data available for this crispr