ID: 1171283468

View in Genome Browser
Species Human (GRCh38)
Location 20:23919786-23919808
Sequence ATGTGTACATACATGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171283468_1171283471 20 Left 1171283468 20:23919786-23919808 CCCACATACATGTATGTACACAT No data
Right 1171283471 20:23919829-23919851 ACATGCATGCCCCTCACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171283468 Original CRISPR ATGTGTACATACATGTATGT GGG (reversed) Intergenic
No off target data available for this crispr