ID: 1171286371

View in Genome Browser
Species Human (GRCh38)
Location 20:23942301-23942323
Sequence ACACTTTCCCATCCAATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171286370_1171286371 -8 Left 1171286370 20:23942286-23942308 CCATTTGTAACAGACACACTTTC No data
Right 1171286371 20:23942301-23942323 ACACTTTCCCATCCAATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171286371 Original CRISPR ACACTTTCCCATCCAATGTA AGG Intergenic
No off target data available for this crispr