ID: 1171286765

View in Genome Browser
Species Human (GRCh38)
Location 20:23946095-23946117
Sequence TCCCTATGTCCAGGGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171286758_1171286765 15 Left 1171286758 20:23946057-23946079 CCTGCATTTCATTATACTCCTGT No data
Right 1171286765 20:23946095-23946117 TCCCTATGTCCAGGGTGTCCAGG No data
1171286762_1171286765 -3 Left 1171286762 20:23946075-23946097 CCTGTTAGGTGGTTTCAGGATCC No data
Right 1171286765 20:23946095-23946117 TCCCTATGTCCAGGGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171286765 Original CRISPR TCCCTATGTCCAGGGTGTCC AGG Intergenic
No off target data available for this crispr