ID: 1171287685

View in Genome Browser
Species Human (GRCh38)
Location 20:23955405-23955427
Sequence TTGTGTATAAATAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171287685_1171287688 9 Left 1171287685 20:23955405-23955427 CCTTCTGCCCTATTTATACACAA No data
Right 1171287688 20:23955437-23955459 AAATTCAATGTCTTATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171287685 Original CRISPR TTGTGTATAAATAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr