ID: 1171288438

View in Genome Browser
Species Human (GRCh38)
Location 20:23964424-23964446
Sequence CTAATTCAACAGTTATCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171288438_1171288439 19 Left 1171288438 20:23964424-23964446 CCTTTAGATAACTGTTGAATTAG No data
Right 1171288439 20:23964466-23964488 CAATAAGAATACATCTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171288438 Original CRISPR CTAATTCAACAGTTATCTAA AGG (reversed) Intergenic
No off target data available for this crispr