ID: 1171289085

View in Genome Browser
Species Human (GRCh38)
Location 20:23969957-23969979
Sequence CAGTGGATAACTAGTACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171289082_1171289085 5 Left 1171289082 20:23969929-23969951 CCATGCCTCAGGGTATTTTGTTA No data
Right 1171289085 20:23969957-23969979 CAGTGGATAACTAGTACACAAGG No data
1171289083_1171289085 0 Left 1171289083 20:23969934-23969956 CCTCAGGGTATTTTGTTACATAG No data
Right 1171289085 20:23969957-23969979 CAGTGGATAACTAGTACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171289085 Original CRISPR CAGTGGATAACTAGTACACA AGG Intergenic
No off target data available for this crispr