ID: 1171289553

View in Genome Browser
Species Human (GRCh38)
Location 20:23974165-23974187
Sequence GCCACTAAGGTCTTCCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171289553_1171289558 1 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289558 20:23974189-23974211 GGTGTCAAGAAGGGCAGCAGTGG No data
1171289553_1171289556 -9 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289556 20:23974179-23974201 CTTAGTGGCAGGTGTCAAGAAGG No data
1171289553_1171289559 2 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289559 20:23974190-23974212 GTGTCAAGAAGGGCAGCAGTGGG No data
1171289553_1171289562 27 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289562 20:23974215-23974237 TTGATTAGTTCTCTGGGTAAAGG No data
1171289553_1171289557 -8 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289557 20:23974180-23974202 TTAGTGGCAGGTGTCAAGAAGGG No data
1171289553_1171289560 20 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289560 20:23974208-23974230 GTGGGAGTTGATTAGTTCTCTGG No data
1171289553_1171289561 21 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289561 20:23974209-23974231 TGGGAGTTGATTAGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171289553 Original CRISPR GCCACTAAGGTCTTCCTCAC AGG (reversed) Intergenic
No off target data available for this crispr