ID: 1171289556

View in Genome Browser
Species Human (GRCh38)
Location 20:23974179-23974201
Sequence CTTAGTGGCAGGTGTCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171289553_1171289556 -9 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289556 20:23974179-23974201 CTTAGTGGCAGGTGTCAAGAAGG No data
1171289550_1171289556 12 Left 1171289550 20:23974144-23974166 CCAGTCAACAGTGGGTTCACTCC No data
Right 1171289556 20:23974179-23974201 CTTAGTGGCAGGTGTCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171289556 Original CRISPR CTTAGTGGCAGGTGTCAAGA AGG Intergenic
No off target data available for this crispr