ID: 1171289557

View in Genome Browser
Species Human (GRCh38)
Location 20:23974180-23974202
Sequence TTAGTGGCAGGTGTCAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171289550_1171289557 13 Left 1171289550 20:23974144-23974166 CCAGTCAACAGTGGGTTCACTCC No data
Right 1171289557 20:23974180-23974202 TTAGTGGCAGGTGTCAAGAAGGG No data
1171289553_1171289557 -8 Left 1171289553 20:23974165-23974187 CCTGTGAGGAAGACCTTAGTGGC No data
Right 1171289557 20:23974180-23974202 TTAGTGGCAGGTGTCAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171289557 Original CRISPR TTAGTGGCAGGTGTCAAGAA GGG Intergenic
No off target data available for this crispr